Transcript

flrt2-203

ID
ZDB-TSCRIPT-131113-3889
Name
flrt2-203
Previous Names
  • dkey-87k14.1-001
  • si:dkey-87k14.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055381 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055381|OTTDARG00000038635|ZDB-GENE-131120-42 si:dkey-87k14.1|OTTDARP00000043435 DKEY-87K14.1-001 LG_ CR759797.14 Danio rerio protein_coding PUTATIVE, 3145 bp
ATTATTCATTACTGCAATTCCTCCCATAGGTTCCAAAGGA
AAACGGAGCTCACTACATTTTGGCATAAACAATCAGATGT
ACCAATTATGGCAGAGGAATAGGACCTACTTTGGTTGTGA
AACAGCAGTGTGAGGAGTGTGTGTGTTTGAAAGAGTGAGA
GAGCGGGGAAAGCAGCGCGCTCCGGGCATTTGGCGAAGGA
AGCGCGGAAGTCGGGAGCGCATCAGCGGGGCTGAAGCTGC
GGTTCTCGGACGCATAATGTTGCGTAGATACTTCAAATCC
TCTCCGGGATCAACCGCTCGTCAAAATGTCGCTTTTTAGA
CCACCCGGACTAAAGGATGGCCGGAGTGACTCCGTTAAGA
GTCTGGAATTATTTTTTAGTTTAACTGGGGGATGCTTATT
TTGAGAACTCGTACTGGAGACTAGAAGACTTTAAAATGCT
GCCCGGATGGGTCAAAGCCTCTTCGGAAAAGGTAAGTGGC
TCAAAATGCTCCTGGTGAGGAAGGTTGTGCCTTACGGGAA
TCGTCCAGCTGCGATGAGAGAGGAGGTCATCTCCGATGAG
CCCTCCATTCTTACTGCTCTGGCCCACACACTTTGAAATC
ATCTCTCCCTAAACTCAGAGTGACAATGTGATGAGCTCTG
CTATCATTTCCAGCCTGAGCATGGACGGAGGGATGAGAGG
GAGTCGCACGAGTTAATGAGACTATTGCTCTTGTGTTGGG
GAGCTTAGGACAGGCAATTACAGGAGGATTACCCAGCGAC
TTCAACATCGCATACTCTCCACCGAGGCAAGCTTTGAGAT
CCGCTAAGAACTCCAGTGTGGTGGATTTTATTTGATTTTT
TTTCTCACCCTTTTTAATTACGTGCACTGTTGTTGTTGTC
AAAAGTTTGTAAAGTCTTACAAAATGGAGGTACAGATCCG
AATGTGGAATAAAGACCTGCCAGCTTTGATCAGCCCGTGG
ATACCGATACTTCTAGGTCTTCACATGCATTTCTCCTGGG
CCACAACCTGTCCAGAGGAGTGCCGCTGTGACAGGACCTT
TGTTTACTGCAACGAGAGGAGTCTAACGTCAGTGCCTCTA
GGGCTAGGAGAGGGTTATAAGACTCTCTACCTCCACAACA
ATCAAATCAACAATGCTGGATTTCCCCTGGAAATGCACAA
TGTTGCCTCAGTGGAGACGGTGTATCTCTATGGCAACCAG
CTCGACGAATTCCCTGTCAATCTTCCCAAAAACGTGCGGG
TGCTCCACCTGCAGGAGAATAACATTCAGACGGTGTCCAG
GGCCGCCCTCGCACAGCTGCTACGCCTGGAGGAGCTCTAT
CTGGATGACAACTCCATCTCCACTGTGGGTGTGGAGGAGG
GGGCCTTCAGGGAGGCCATCAGTCTCAAGACCATTTTCCT
TACCAAGAACCACCTGAGCAGCATCCCCATCGGCCTGCCC
GAAGAGCTAAGAGAGTTGCGGCTAGATGAGAATCGCATTG
CACTTATAACCGAGGACGCTTTCGAGAACGTGACAGGTCT
CGAACTTCTTCTCCTGGACGGGAACCTGCTCACGGATGAG
GGCATCACCCCCGGGTCTCTCCAGACGCTCGCTAATCTCA
AAACCTTGTCAATGGCGCGGAACTCCCTCACGGTTCCTCC
TCCTAACCTGCCCACAGAGTTTCTAATCAAGCTGAACTTG
CAGGATAATCAGATGAATGAGATTCCTTTGACGGCCTTTC
GAGGCCTCCATCGCTTGGAGAGACTGGATATTTCAAACAA
CCAGCTGCAGTCTCTCACACAGGGGGTCTTTGACGGCCTT
CACAGTCTGAGACAGCTCACTGTTCGAAACAACCTTTGGC
TCTGTGACTGCGACATTAAATGGGTCATACTGTGGTTAAA
GTCCCTGCCAGCTACCCTCAACGTCCGTGGCTTCATGTGC
CAGAAACCAGAGAGGGTACGTGGCATGGTAATCAGAGAGC
TAACCCTGGAGCTCATCCAGTGTCCTAACAGCACCGGCAC
AGTCCCACAGCCCACACTGCTTTCTTCCTCCACCGCTGAG
TCAGCCACTCAAACGGCCTTCACACCCGCACGCACCCAGC
CTACACCCAGCCCTCCACCTCTCACACTACTCCTGCCGAC
TACAGGCGAAGATATAGAACAGAGGACAAATGATCCTATC
GGCCCGAGGCAGGAGTCGATGCGCATCTCCTTTGTGGTGC
TTAACAGTTCGTGCATTCAGGTAAGCTGGGTATCAACATT
TGCCGTCACAGCCTATAAGGTGACCTGGGTCAAACTGAGT
CCGAATTTGATAACCGGCCCCATGCAGGAGTCACTTGTGG
AGGGCAAACTTGATGGAATCACACTGAGAAACTTGGAGCC
CAAGTCCACTTATCGTATTTGTGTGGATCCACTAGATGCA
TTCAATAATTATCACCCGGGGGATGATACAATTTGCTCAG
AGGTGACGACAAAGTCTGCTTCTTTTCACTCTGGCGATAA
CGCAACTGGGCCTGAGCAGGCAACCCAGCAGGACCCCAGC
TCGCCTTTCCTACTGGCTGGCCTGATTGGTGGGGCAGTGC
TTGTGGTCCTGGTGGTCCTGTTGAGCATATTCTGCTGGCA
CATGCACAAGAAGGGAAGGTCAGATTCATCAAAATGGAAA
TACAGTCGGGGCAGAAGAAAAGATGACTACTGCGAGGCGG
GGACTAAAAAGGATAACTCTATTCTGGAAATGACTGAGAC
CAGCTTTCAGATAGTTTCTTTGAATAACGAACAGCTGCTC
AAGGGGGACTTTCACATCCAGCCGATTTACACCCCTAATG
GGGGTGTTGGATTCAGAGACTCTCAAAGGAGAAACAATAG
CACAGCATACTGCAAAAACAGTGTTCCAGAGTCTGACACA
TGCCATAAATGATGATTTTGAGCCGATAATGTCCTTTGTA
TTCAGATCTGACTCTTAAATGCACTGTATTTCAAAAGACA
GACTGTACAATATGTAATTTATATTCTGAACAATATCGCC
TTCTTTTTTATCGCTTAGTAAAACTTAAATGATTTAAGAA
TATTTCGTTTCTATGTTGTGTTAGTACAATCCAAGCTCAT
AAAAATATGGCAAGTGGATCTTAGCAACAACCAATCTTTA
AGCACAAAATCAATGTCAAGTGCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations