header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3843
Transcript Name: myct1b-201
Previous Names: myct1b-001, ch211-195g8.4-001, si:ch211-195g8.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055225 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055225|OTTDARG00000038546|ZDB-GENE-131127-631 myct1b|OTTDARP00000043320 CH211-195G8.4-001 LG_ CR407704.10 Danio rerio protein_coding PUTATIVE, 811 bp
GGATTGAGCATCTGACTGCATGTTGACGTGCATCTGCAAA
CCAGTATGGCTTCAAATGAAACAAATGCGCTTCAGGAAAT
GCTTAAAAATATTGATTTTGAGGAGCTCATCCTGGCATTC
TGCTTGTCAATGTTAATCGGTCTGCTCATCGGGATCTTGA
TTTTCCTCCTCCTCACATGGATGTCAAGAACCAGAGCTTC
GGTCAGGATGATCAGACATCAAACCCAGTCTTCAGAATCG
AAAGGCTGTCACCTCAAACACTACAAGAGTCACGGCTTTG
ATAAGAACAGTGAATATGCTGGAAGAGCTGCTTTAAATCT
GCACAGGCAAACGTCTGTAGACCCCAACGAGCTGCTGGGA
AGGAGCCCCAGCTTTCAGAACTCCACTTTTCGGCCACCTG
TAAAAAAGACTAAAAAGAGCAGCGATGAAATGGAGGATGA
TAATCAAGCAGCTTTACTTCCTAACATCACAGATCCATTT
AGTATGGAGCCAGCTGAGTCCTTCTGGCTGGGGAAAGGCA
GTTTAAGAGGTTTTCTGCCCAGACAGACTCCGCCACCTGC
ATATGACAGTGTCATTCACATCTTTCAGGAGACATGTACC
TGACTGCAATGTGAATACAGACTATGGACCTGCGAAAAAT
TTTACATAAATCACAAAACATGGATTAACCACAACAAAAG
GAGAGAAAATCTAACAGAAGCCTTGAGAAGGATCTGACTT
ACTTATTTGCATTACTAACCCTTTGCAATAAGGTGCCATT
TGTTAAAGGGATAATTCACCCAAAAATGAAAATGTCCTTA
TTGTTTACTCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myct1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055225 (1),  Ensembl_Trans:ENSDART00000131200 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)