Transcript

zbtb42-201

ID
ZDB-TSCRIPT-131113-3828
Name
zbtb42-201
Previous Names
  • zbtb42-001
  • ch211-193k8.4-001
  • si:ch211-193k8.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055156 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055156|OTTDARG00000038492|ZDB-GENE-130730-2 zbtb42|OTTDARP00000043256 CH211-193K8.4-001 LG_ CR855301.19 Danio rerio protein_coding PUTATIVE, 1656 bp
CGCTCTTTCTCTCCGCTCACATGGACGGGCGAGCAACTGC
GCTCAGCTCAGTCTGAAAGTCCGCTCTTCTTCGCGGAGTT
TGGAGAAGATGTGTGCGTGTTTGTAGATGTGTGTGTGAGA
GAGATCTGCATGGCTGGATTTGCTCTTCTCCTCCGCTGCT
GTTTGATGAGAAGCGCAAACTGAAGAGAAACTCGCGGATT
TTCGGGGTTTTCGTCCATAAGAATGGAGTTCCCCGACCAC
AGCCGGCAGCTCCTGCAGTGTCTGAGTCAGCAAAGACAGC
AAGGTTTTCTCTGCGACTGCACGGTTCTGGTAGGAGAAAC
TCGTTTTAGAGCGCACCGGGCCGTGTTGGCCTCCTGCAGT
ATGTATTTTCACCTCTACTACAGAGATCAGCTGGATAAAC
GAGACGTAGTGCTTTTAAATAGTGACATCGTGACGGTTTC
AGCGTTCAGTTTGCTGCTCGAGTTCATGTATGAAGGAAAG
CTGGAGTTCAGTGCAATTCCTGTAGAGGACGTCCTGGCGG
CGGCTAGCTATCTGCACATGTACGACATCGTAAAAGTCTG
CAAATCCAAACTAAAGGAGAAGGAGCTGCTGCCTGAGGAG
CAGCAGAAGGCCAACGGTGTCAATTATGTGGCCGAAACCT
GCGTCCTAACAGCTGGAAAAACAAAAGCGCATGTCAGTAG
TTCGGCCTCGTCCCAAAGGTCCCGGGATGACACGGACTGC
GCGCTGGATTTGTCTTTGAAGCCAGTGTGGATTGGGGAGT
TTTCAGGACAGCTGGCCCTCGACAGCCAGCAGCAGGACAC
CCAGACACTTGTTAAAGAGCAACACGACGTGCTGTCAGAG
CAGGAGGACGCTGATCCGGCCAGCCCCGAGAGCCGGCGCT
TTGGGAATAACGGCAGGAGTGCGGCGGTGACAGGGTTCAG
TGAACTCTTCCCCCGAAACAAGCATGAGGATCTGATGGAG
GAGGAGCTGAGTGGTGTGCGCTCGCAGCGGCAGCTGGGGG
ACAGTGAAGGAGACGATGAGGAGGATCTGGCATCCTCGGA
CATCTCCACATCAAGTGGCGTCCTGCTGTCGTCGGCTGGT
GCGCAGGTGTGTGTGTGTCCACTCTGCAGCAAAGTGTTCC
CAAATCCCCACGTCCTGCAGCTCCACCTCAGCTCACACTT
CCGGGAGAAAGACGGCGTGCGCTCCAAACTCTCCCCGGAC
GGATCCGTGCCCACGTGCTCGCAGTGCGGGAAGACCTTCT
CCTGCATGTACACACTGAAGCGGCACGAGCGCACACACTC
CGGGGAGAAGCCGTACACGTGCGCGCAGTGCGGGAAGAGT
TTCCAGTACTCGCACAACCTGAGCCGGCACGCCGTGGTGC
ACACCCGAGAGAAACCGCACGCCTGCAAGTGGTGCGAGAG
ACGCTTCACGCAGTCTGGAGATCTGTACAGACACATACGC
AAGTTCCACTGCGGCCTCGTCAAGACACTCGCCATCGGAT
AACACTGGAGCCAGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTCATTAGCTGGAGGAATAATAATAAGCAGAATCA
TGATGATGGTGATATCTAGTATTTGCAAGGTGGAAGGAAT
GAAAAACACAACAATCATGTCTCTAGAAATCAACAATCTG
ATGCACTTGGGATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations