header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3805
Transcript Name: tac3b-201
Previous Names: tac3b-001, dkeyp-41g7.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055080 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055080|OTTDARG00000038444|ZDB-GENE-120716-1 tac3b|OTTDARP00000043198 DKEYP-41G7.2-001 LG_ CR847871.5 Danio rerio protein_coding NOVEL, 830 bp
CTGAACAGCATCCTGTTAACACCAGCTCATACTAGTATTT
GGATAAGGTGTGCGAGGATGTCCTGCGGCTGGCTGCTCGC
GCTGCTCGTCCACGTGCTGCTGCTGCTCGCGTGCCCGAGA
CTCTCGCGGAGCGCCCTCGACTACTCCTTCACTGACAACA
GCGACGCCCAGCCGGAGCGCTACGACAAACGATATGATGA
TATTGATTACGACAGTTTCGTCGGCCTGATGGGCAGGAGG
AGCACAGGAATAAATCGTGAGGCACATTTGCCATTTAGAC
CGAATATGAATGACATCTTTGTCGGACTGTTAGGACGGAG
AAACACTTTGTCGTCTATGAGAAAAGAAAGGAGAGGGAAC
ATTTTCTTCAAGGATGGAAGACTGAGGTTTTGCTGTGGTG
TATGAAGCTTTCTCTACGAACTAATCCAACATCACACACA
CACACACACACACATGCGCGCGCACACTCACACACACTCC
ACATTTCATCCATTTTAGTATTCTTTTGGCTAACCTTTGG
TACAGATTTAACCAAACTTGTGTCAAATAAATCTTTTTAA
ATAGTTTCTTAAGTAATAACAGTCCTGTTGTATTCAGATG
AATGAAGATTAAAGCATGTTGGCCATAATTTGTGCAATAT
TGTGCTTGTAACTTTTCAATTTAAAAACATTCATATTTAA
AATGCTGTAAAATATTTGATTTTATTCATCGATAATACGA
CAGTTTACTGTAAAATAAGTCTTTATTTTAAGATGCTGGT
TATCATTCCTCAGTAACACACTTTTCCTCACACACTCTTT
TATAAATAAAAGATTGCTGTGGATTTACTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tac3b-201 Contained in:
[BAC] DKEYP-41G7 (1)

OTHER tac3b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055080 (1)
  • Ensembl_Trans:ENSDART00000156187 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN838429 (1) 865bp
    GenBank:EV560472 (1) 625bp
    GenBank:AL914893 (1) 538bp
    GenBank:BI845315 (1) 487bp
    GenBank:BI845643 (1) 457bp
    CITATIONS (2)