Transcript

si:dkey-6e2.2-201

ID
ZDB-TSCRIPT-131113-3766
Name
si:dkey-6e2.2-201
Previous Names
  • dkey-6e2.2-002
  • si:dkey-6e2.2-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054949|OTTDARG00000038352|ZDB-GENE-131121-72 si:dkey-6e2.2|OTTDARP00000043104 DKEY-6E2.2-002 LG_ BX936390.7 Danio rerio protein_coding NOVEL, 2751 bp
TCTGGCGCTAGAGGGCAGCCGTCGTCCGTTTGAGCCAATC
AGAAAGTTCAAAACGAGTGACGCGCGTACGTCGTGCACTC
GCAGGCCTGCGTGAAGCGCGAGTGGCAAAACCAACGGGTG
TTTTAGCATAAATGAACGCTTTACGAGATTCCTCACGGTT
TCCACGCCGCGAAATGTTCGAGGAGATGTCAGTGGAGAGA
AACTGGACGGACACCGAGACCAGGGCTCTGCTGTACATCC
GACAGGACGAAGAGATCAGCAGGCAAATCAGCGGGACCGT
TCGCGACTCGCTAATATACGCCGAAATCTCGAGGCTCCTC
AGTGCTCAGGGGATCCACAGAACCCAGCGGCAGGTCACAA
CCAAGCTGAAAACCCTCAAGCAGAAGTTCCTGAAAATACA
CGAGCACCACAAAAACAGCGGGCACGGGAAAGTGTACTGG
AATTGCTATGATCTCTGCAAGTCTATCTGGGGCAGCGGAA
GACCCACAAACACTTCAACACTTCATCATAATAATAATAA
CACAGTGAAACTCGAAGAGCCGCAAAGTACATCCATTGAA
GACGCGAGAAATGAGAGCAGATCCACGGATATTGAAGTGT
CCATCAGTCACGACGAGGAGACCGATGACCTGACAGAAGT
CACATGCACACAGCTCTCCAGTGAGTGCACAGCTCTTTAG
GCCACACCCTCCTCATCAACAGGGCTTTTCTCCGTCACAT
TCACACAGCTCAGATCTTCTCTTGAACACTTCTCACTTCA
GCACAACTACTGAAGCCACACTGCTGCCTTTCAGCATAAA
GACAATATCCAGCAAAAACTATGCCACGTCCGCTGTCTGA
AGTGTGGAAACATTTCACCCCAGCATGTGTTTCAGGAAAG
GCTGTGTACATTTGCAATTACTGCGCGCAGCCGTATGTTA
AGAACGCCACAAAGTTGCAGCGACATATAGTCAAGTGCCT
AATGTCTCATCAGGGGTCAATGCAAGCAGCGACCGGCAAG
AGTTTCTCTGTTAACATTAGAAGTGAAGATGACTCCAGTG
TTCACCCTCTCGACAGCTCTAGAATCGAAGGACTGATGAA
TGTTAGTGTCGCTCCGCCTGTGAAGAAGAAGCCCAGAACT
CATTTGACTGTGGAGCGTGTTCGTGATGAAGAGCCTCTGC
TTGTGCAGAACCAGAGGGAGTTTGAGGAGCGCTGGCGGCG
GGACGCCAGAGAGGAACACAAGGAGGAACGGGCCAGTCTG
ATGACCATGTGGAAGGAGATGATGGAGTTTCAAGGGAACC
TCTTAAAGGAGTTTATTCACCGCTCATCCTCGTCTACATC
TCTGCCTTCACTTCCGTCTTACAGCAGACCTGCTCATCAC
AATCAAGGGCCATCTACATTTCCAAGCACTAGTTACATGG
CACCATACACCTCGCCAGAAGCCGAAACGGAGAACGAGAG
CATGATCTCGCATGAGGATGACGAGGAGGAGGAAGAGGAG
AAATACATCATAACAGCTCCGATTGCCCCTGTGCCGGACT
CCCAGCCTGTAAACCACGTAAACGACAGCCAATCAAAGGC
CACAGAGACGCTTACACCTGCGGCCACACAGACATCAGGA
CAGAGCGATCTGCAGACGACAGTGCTGCGCAGACAAGAGA
GAGTCCTGCAGCTTCAGGAGGAGTATTACTCTCTCAAAAT
CCAGCATCTCAAACACAAGATCAGCAGAGACGCTCAACAG
CACCAACAGCACAGTTAGTGCGTCCATTCACTACTTTCAC
TGTCAAAATGATCAGCACCCTTGGGAAACATGACCAAAGA
AGGCTGTGGACAAAAATAGGATTGATTGTCCACTCGTTTC
TGTGAAATGTAAGCAAAGAGCTTAGAATGACCAAGAGGCG
ACACTCTAGTGTAATTTGGGAAACAGCCACTAGAGGGTGC
GGTGGCCATTTTGGAATGAAACCTCCAATTGAACAACAGC
ATATTATAAGTCTGTAAAATAAACTATTAAAAGAGCTGAT
GATTGTGATAATAAGTGTTGTATTGTCGTCTTTCAGGTTG
TATCTAAGTTTTAATGCGCTTTTTAAATAAATAAATAAAT
AAAAAACAAAGCAGCTGCTTGCTATCGCAACAGTATTGGG
ATCCAATGGACAGCCGATCACTTTGACTCCAAAATGGCGG
AATCCAGGGCTGTTGCTGGGCACTGCTGTTGCAATGAAAC
GTTCTATTGAGTGTTGCCTCTTGGTCATTCTAAGCTCTTT
GATGTAAGGGTTTGTGAAATGTATTTGTTTTAAATGAAAG
CATTTAAATGTTTGTATTTGAAAAGGGTGCCAATCATTTT
GATCACATATGTACAGTTCAAGTCAAAATTTTTAGCCTTC
CTAAATTATTAGTCACCCTGTACATTTTATTTCCCAATTT
CTGTTTAATAGAAAGATTTTCTTGCAACACATTTCTAAAC
ATAAGTTTTAATAACCCATCTTTAATAACTGATATATTTT
ATCTTTGCCATGATCACAGTAAATAATATTTGACTAGATA
TTTTTCAAGATACTAGTATTCAGCTTAAAGTGACATTTAA
AGGCCTAACTAGATTAATTTGGTAAGTTATTGTATAACAG
TGGTTTGTTCTGTTGACGATCGGAAAAAAAATAATGCTTA
AGAGGGCTAATAATCAGGGTTTCTGCGGGATCTTATAAAG
TCTTAATGTCGTCGGTGAAATAGCCTAGTGGTTAGCGCAC
TGACACATGGTGCAGTAGCACTTCCGGGCGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations