Transcript

znf973-202

ID
ZDB-TSCRIPT-131113-376
Name
znf973-202
Previous Names
  • dkey-3p4.2-001
  • znf973-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052710 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052710|OTTDARG00000036995|ZDB-GENE-131118-32 si:dkey-3p4.2|OTTDARP00000041436 DKEY-3P4.2-001 LG_ CR556708.14 Danio rerio protein_coding PUTATIVE, 1657 bp
TGCGCCGCTCTTGCGCTGGATTCAGCTGGAGAAAGGATAA
AGTGTCAGAACACAGAGAAAAACTCCTGCTGAAGCGACTG
ATCTCCACACTGTTATAAAGATGGCGTTTATTAAAGAGGA
GAGTGAAGATGTGAAGATTGAAGAAACATTCACAGTCAAA
CAGGAAGATCTGCAGGAACAAACAGACCTAATTGAAGAGA
AGGAGGGGAGTAAAGAGGAGGAACATCATGTTAAAATTGA
GGAAAAAACTCATTTACAGACTGATGGTATATTGAAAAGG
AGAGACAAAAATAGTTTCACCTGCACTCAGTGTGGAAAGA
TTTTGGCAAGCAAAAGCAAACTTAAGATTCACATGAGCAT
CCACACAGGAGAGAAACCATTTACATGCACTCAGTGTGGG
AAGAGTTTCAGCCTATCATCATCCCTTAATCTACACATGA
GGATCCACACTGGAGAGAAACCATACACATGCACTCAGTG
TGGGAAGAGTTTTAGCCACTTATCACCTCTTAATAAACAC
ATGAGGATCCATACTGGAGAGAAACCATTCACATGCACTC
AGTGTGGGAAGAGTTTTAGCTTATCAACATCCCTTAATCT
ACACATGAGGATCCACACAGGAGAGAAACCATTCACATGC
ACTCGGTGTGGGAAGAGTTTCAACTGCTCATCAAACCTTA
GTAAACACATGATGATCCACACTGGAAAGAAACCATTCAC
GTGCACTCAGTGTGAGAAGAGTTTTAGGATATCATCATCC
CTTAATCTACACATGAGGATTCACACTGGAGAGAAACCAT
TCACATGCACTCAGTGTGGGAACAGTTTCAGCCAATCATC
ATCTCTTAATAAGCACATGAGGATCCACACTGGAGAGAAA
CCATTCACATGCACTCAGTGTGTGAAGAGTTTCAGCCGAT
CAGAACACCTTAATCTACACATGAGGATCCATACTGGAGA
GAAACCATTCACATGCACTGAGTGTGAGAAGAGTTTTACC
TGCTCATCACACCTTAATCGACACATGAGGAAACACACTG
GAGAGAAACCATACGCATGCACTCAGTGTGGGAAGATTTT
CAGCCAATCATCACGCCTTAATCTACACATGGTAAGCCAC
AACGGAGAGAAACCATGACCTACGAAACTCTGACGGACTC
TGACCTGCGAAATTGCATCACTTGACTGTGTGAGACCAAT
TGAAGATCAAAACATGACCTCTCTGGACCGAAATGTTAAA
AAATGTACCAATCGCACACTGTTTTTATCATCTTGTTTGT
TCCCGCTCCTTTTCGCAACGCCGTACAACAGAATTTTGCA
TGCTCTAACTCTAGTGTGACCGCAGCTTCGGTGTGGGATG
AGTTTCAGTAACTCCTCAGACCTTAATAAACACATAAAGA
CCCACACTGGGGAGAAACCATTCACATGAACTCAGTGAAA
GAAGAGTTTTAACCGATCAGCAAACCTTAATGAACACATG
AAGATCCACACTGGTGTGAAAGAGTATATGTGCGTTGAGT
GTTAGAAGACTTTTATTACAAAATTGAAACTGCACCAGAC
GTTTTACACTTGAGAGACTATACAAGTGTTCACACTGTGA
CGAAAGGTTTAATCAGTGAACACATCTGAATCACACAAAA
GAGGATTCACGGCTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations