ZFIN ID: ZDB-TSCRIPT-131113-3735
Transcript Name: tgm8-201
Previous Names: tgm8-001, ch1073-127n10.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054832 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054832|OTTDARG00000038266|ZDB-GENE-120718-3 tgm8|OTTDARP00000043017 CH1073-127N10.2-001 LG_ CU855794.4 Danio rerio protein_coding NOVEL, 1032 bp
CCCAAGAACAGCCAGGACAGTGTGTGGAACTTCCATGTGT
GGGTGGAGGCCTGGATGAGGAGACCCGACCTGACAGAGGA
CACACTGTATGACGGCTGGCAGGTGCTGGATCCTACACCA
CAGGAGAAGAGCTCAGGCACGTACTGCTGTGGTCCGGCAC
CAGTCATGGCTATCCTGGAGGGTCACACAGAGGTCAAGTA
TGACGTGCCCTTTGTGTTTGCGGAGGTCAACGCTGATCGA
GTGTGCTGGCTGCTGATGACGGACGGGTCCAGGAAGAAGA
TCATGTCAGACAGCAGAAGTGTGGGTCAGAACCTCAGCAC
TAAAGCTGTGGGCAGCAGCAGCCGGCTGGACATCACTGAC
CTCTACAAACACGGCGAGGGCTCAGCGCAGGAGAGAGCCG
TCTACACTGAAGCTGTGCACAGACTGACTGACCTGCAGAT
CCCCGAGTCTCCTCCAGTCAGTGTTCAGATGAGGCTCAGT
CTGGACGTCCCGCCGCTGAACGGAGCTGATGTTCCGCTGA
AGCTCTTCCTGAAGGGCAGCAGAGCGCAGTGTGTGTGTGT
AAACATCAGCGCGCAGGTCATGAGGTACACTGGAGCCCCG
GCGGCTGCAGTCTGGAGCCACAGCACTGATGTCCAGCTGC
AGGACACTGAGGAGAAAGCTCTGTCCTTCACACTGCCGTA
CTCTGCATACGGACACAGAATGCTGGAAAACAACTGCATT
AAAGTCTCCGCCATCGCTAGAGAGAAGAACAACCCAAAGG
ACACATATCTGACCGAGAAAAACATCATTCTGCACACTCC
AAACCTCAGCATCACTGTAAGCGGTTCTCCTCTGCTGGAC
AGTGAGATGACGGCTACTGTACAGTTTGAGAATCCTCTCT
CCTCAACGCTGCAGAACTGCTCCATCAGTCTGAGCGGCAG
TGGTCTGCTCAAAAGCACAGAGAAGTCCAGTACGGTGCAG
CTCGGCCCGGGACAGAGGATCAGACTGCAGGTCAGCTTCA
CACCCTACAGACTGGGACTCAAGAAGCTGATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tgm8-201 Contained in:
[Fosmid] CH1073-127N10 (1) (order this)
OTHER tgm8-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054832 (1)
  • Ensembl_Trans:ENSDART00000155009 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN899830 (1) 670bp
    GenBank:EE211439 (1) 631bp
    GenBank:AW566568 (1) 513bp
    CITATIONS (2)