Transcript

raver2-201

ID
ZDB-TSCRIPT-131113-3721
Name
raver2-201
Previous Names
  • raver2-001
  • ch211-201n5.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054687 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054687|OTTDARG00000038166|ZDB-GENE-090713-1 raver2|OTTDARP00000042931 CH211-201N5.2-001 LG_none AL954175.6,BX663603.13 Danio rerio protein_coding NOVEL, 6831 bp
TCAGAATGGTTTAGTTTTCCATCGGTGGAGGTCGCCAGCT
GTACTGTGCTGGGCTTATCCATACTTACTTCCAAGAGTGC
CGTCGATGGGTTTGACTCAAAGCACAGACGCCCACCTATC
CGCTCTCTCCGACTCACTTTCCACTGAGCGCTTCAAAATG
GCGGCCGCTTCATCCATCCAGCCGCCGAGCGTGCACGGGA
TAAAGCGGGACAATTCACCTCACCCGGAGTCCGACAGCCC
CGTGAGCCGACATGAGGAGGACGCAGCATCCGAGGGGACC
ACCATCCTCAGAGACCTACCGGAGCTCGAGCCCGAGGAGA
TCGAGAAGCGGCTGGAGAAAACTCGCAGAGAGCTGAGCAA
CAGGAGGAAGATCCTTATTAAGAACCTGCCACAGGACACA
ACCAACCAGGAGGTCCATGAAATTCTGCGCGAGTATGAGC
TGAAATACTGTTTTGTGGACCGGAACAAAGGAACAGCTTT
CGTAACCCTTCTAAATGGTGACCAAGCACAGGATGCCATC
CGAACTCTGCACCAGACATCAGTCCGAGGCCGTGACATCA
ACGTCCAGCTTCAGCCCACAGACTCTCTCCTGTGTGTCAC
CAATCTGCCCTACACTGTCACTGCCACTCAGTTTCAGGAA
CTGGTGCGATCCTACGGCAACATCGAACGCTGTTTCCTGG
TGTACAGTGACCTAACAGGCCACTCCAAAGGCTACGGGTT
TGTGGAGTACATGAAGAAGGACTCAGCTTCCAGAGCACGG
TCTGAACTCTTGGGCAAGCCAATGGGCGACCGTGTTTTAA
TGGTGCAGTGGGCTGACGTCAACCAGCTGACCTCTGCTGA
CCACCTCCACTCCAAGTGCCTATGCGTGGATCGACTGCCA
TTGGACTTTGAGGACTCGGAGGAGCTGGCTCACATTTTTT
CAGAGAGCTACAAACCCGTCTTCTGCCAGTTGGCTCAGGA
TGAGGGAAGTCCGGTCCGGGGTTTTGCTGTAGTGGAGTAT
GAAACAGCAGAGCAGGCTGAAGCTGTGCTGCTGGAGATGG
ACAGACAGCTTATCCAGGGTCAGGAGATCCGTCTGTCTCT
GTGTCCTCCAGGAACTTCTGGACGCAGCACACTCGCCGCC
CTCATCGCTGCTCAGGGAGTGATGTTGAGCAATAAGAAAG
GTTTGCTGCCAGAACCCAATCTGGCCCAGTTCCTCAACAG
TATGACCAATCCTGCTGCTCTCCAGGTCCTCATGAGACCC
TACCCCACAGCCAAACGAGGAGGGAAGTTTGGTCGACCTC
ACAATCTTCCTTTCCTGCGTCCTCCATTGACTGCAGCGCT
GCTACAGTTAGGGAAAGCACAGCAGAGTGCCATTCTAGGA
AACGGCCTTGTTCTACAGAATCTTCTTCACATGCAGATGG
CCCAACAACAGCTTTTACAGATCAAAGACAAGCAGATCTC
TAATGTGCCGGGTCTTTTAGGTGACCCCTCCCGGCTGCTC
CTCCAGAAAGTTCTGGGTTTACGAAATCCGGCGACAGTTC
CTTTGGGAAAGGGCTTGCTGGGAGATTCCCCCACAGAGTT
GGGACAAGACTCTTCTCTAGTCACTTCTCACGGTGTAAAC
TCTGGGATGGTGTCACATTTACCGGGACGTTCCCTCGCTG
AGCAGAATGGAGTCGCGTTGACGTGCCTGGCTCCAGAGAA
ACAGCCTGCTCCACCGGGAACCACAGGGGGATCTCTAAGC
TCCCAAACACAGCTGCAAAACTTCCTTCCTGGGATTAACA
CTTCAAGTCTTGGATCTTTACTGGGGAGCGCAGCGCACAA
AACTCCAGCCAATCATCACAGCGCAAGTGTGCAGACTAGT
ACTTCCGTTACGAGTCAGTCCGGCTGTCAGACGTCTCTGC
TGGGAGACCCTCCTAAAGAAGTGAAGTTGCCTTCCAACCC
TTATCTAAACCTGGCTAGTGTGCTTCCTGGAGTGGTACTA
CAAGCTCCCTGTAACAGTAAACCTCAGACGGTGCAGGCTC
ACCCAGGGACTTACAGCGCGGTCCTACCACCCGCCACCCA
AACGCACACTCAATACAACGCAGAGAGCGCTCCTGCAGAA
TACACTCAGCAGTACACTCAGCAATACACACAGGAGGCCA
TGCAGCAGTGGTACCAACACTACCAAGCACAGACCTACGG
CAACACTAGTCAAGATACGACAGCAGTTACTGACTGCGCG
AAAGAGCAACCTCAGGTGGTGGTCACCTCCTCATACGGAG
ACTACAGCTCCTACATGCACGCTGTCAGTCAGTACTATTC
TCAGACGCAGATGAACCAGACAGCTGCTCAAGTCTACCAG
CACCGAGATGTCAGCAAGGAGGTGGAGGTGGTGAAGACCC
CCTTGAGTGCTCCTCTGCAAACCTCTCTAAATGGCAGCGC
TCAGACCTTGTTGCCCACCTACAGTGCCCTTCCCATCATG
CCCGGCTTCATCACACCAACACACACACATGCAGCCAGCC
CTGCCACACACACACCTGCTGCACCCGCAGCCACCGACTG
GAACAACTACTATTATAGTCAGGCTAGAGGGCAGAAGCGA
GAATACCCCACACTGCCCACGCAGGAAGTGACATCCGAGG
GGCCGTACGTAGGCCAACACTCGCAGGGTCTCGGAGGCCA
GTACGCCGACTACTTCAAGAAGAAGAGAATCTAAGTGAAA
ACTCGCTCGCTGTACGTCGCCATTGTTGTCGTGTCCAGGC
CTTAACTTGTAGTCTATAACTGATATTTATGAAAAGATTG
TACATTGCATTGTGCGTATATGGAGGGTTATTCTCCGTCT
TGAAGCGTATGTGGATCTGTTGTTGTTTCTGTCCCACACC
AGGCAGGAACTCTCTAGCTTCTGTCCCAAATGACGCGATA
ATTGATAGTTTCTGTTTTGCCTTTATATGAACCATTCCAC
TCTAGAGGGGCGGGGGGGTCTGTGTTCGTGTGTTACTGTA
CAAACGGTTAAGGGCTGATAAAGATAGAGCTACACTCAGA
GAAATAACCATTTACAAAAAAAAAAAAAAGAGAGAGAGAA
TAATAATACTACTAATAATAATTTTCTCTGACGAAGAGTA
GGGCTTAGCCAATGTACATTGTATATTCTGGTATATGAGT
GTATTTTTTACGCTGTACAGACATTATGAGACTATTCAGA
ATATTGCGTCTTGCTTTACCGTGTGATTATTTATCTGGAC
TATGGATTCCTGATCGCACATACTCGTCTCTGTACATACT
GCTGTATCTGTAGGAAAGATCAGCCATTCTGAATACTGCA
GGAGCCTTAAAACTCGGCGTTCGGAGAAGACATGGCTACG
GCAATAACCTCTACCTTCTCTGGAGAATCTAACATCACCG
CGCACTTCAAGGTGACTTTTTTTCCCCTCCCAGGTGTCGG
TGGGGTGACTTTCCCCAAAACTTTCAGCTACAACGCTGCC
AGTGGTTTGTTGCTAACAACAGTAAGAGTAATAATAATAC
ATTACTATAGTAGTAATAATCATTTGCTGGATGGTCGTCA
GGGGTTGAAGTGGTTATGTATAGGATAAAGCCCTGATGCA
CACACCCACATGGTAATAATCAAACATAATGCCTTTATAT
GGATATTAGTGCTCTGCTGTTTTGTGGTTTAATTTTTTTT
TTTTACATCTTTAATTGGAGAATCTGCATTTTTGTGATTT
TTACTCTGCAAAAAATCCAGTTTTTTAATCTATATCAGTT
GCTGCCAAGATGTGCTTTATTATTGATACAAATACTGATG
TATCTTGAATATGAGCGCTTTTATATTGCTGCGTGGCAGA
TTTGTTTAATCTTTCCACTTTATTTGTCTGAAGGCAAGTG
TCAGAAATGTTCCAGTGGGATAAATGTAGTCTTAAAGGAG
CAGTTCACCACGTTTCCAAATAACTTTTAAACCAAAAAGG
GCTAGAAACTATTTTTTAAAATGTTCAAGTTGATTTTTCA
AACTCATTTTAGACAGATTGTTTGATTTTTTATCTAAATT
GTCATACAGTATTGTTCAAAATAATAGCAGTACAACGTGA
CTAACCAGTATATTTTTATTAATACATGGCAAACTAGTTA
TCAGTAGGGGGGTAGATTCTCCGAAAACAAACAAGACCCA
GCATTGATCATTTGCATGCTCTTAAGTCTGTGCAATTAGA
CAATGAGTTAAAAGGGGTGTATTCAAAACAAAAATAGCAG
TGTCTGCTGTTGACTGTACAGACGGAAAAATATTTTGTAC
AAACGTTTGTGTTTCTAGGATTTAGAAATCCTGTGAATCA
CTAAACTAATTTTTAGTTGTATGATCACAATTTTTTATAA
CTGCTTTACATCTGTGTAGAGTCATATGGTTAAAAAAAAC
AAAAAAAAAAGGATTATTCTGGTTAGTCACGTTGTACTGC
TTTTATTATTAATAATAATGGGGGGGGGGGGGATCTCCTC
ATCTATCACTAGTGTGCAGCATCCACGCGACAGCAGCCAT
ATTGCGCCCGGCGACGGCACACCACACACCAGCTGATTGG
TGGAGAGGAGACAGTGAGGAAGCCAATTATGAAATGGCAA
TAGTTGGGAGGCCAGTGGGAAAATTTGCACAGGATGCCGG
GTTTAAACTAAACCCCTACTCATTTTCAAGAAACATCCTG
TGATTTTTAATGACCACGAGGGTCAGAACCTCGGTTTAAT
GTGTCATTCGAAAGACGGCGCTCACTGAGCAGTATAGAGT
CCCCATCAACATACTGGGGCGTTAGGACCACCACAAACCT
CAGGTTAAGCGCCCTCTGCTGGTCTCAATATTACCACTTC
CGGCAGCAACCAACCTGGGTCTCCCATCCAGGTACTGCCC
GGGCACAGTCCTGCTTAGCTTCAGTGGGCGACCATTTGAT
TGTTGCAGAGAGCTAGCTGCCAGCTATAATTTTGAATACT
GTACGTCATCTACAAATAAAGAACGAGAATAAGCAAATGA
ATGTGTCCGAGCTGATTGGTCAAAGGTGATGAATCGTTAC
TAATAATTTGTTTTTCAGCTATTGAGTAAAATCCTCCTCA
ACTGTCTTTAGTTACACAATGTTTCAGTTAGTCTGATCCT
CATTGCTATGCTTTGCTCATTTAGTTCCTGTTGTGCTTGG
TCTCAATAATTGCTGCTTGCAGCTAGATTTGAAAGTAAGC
TTTTATTTGTTTTTTGTTCAGATATCAGAATGCATTCATC
ATTTTTAATGAACATTTCCCTTTTGTTTTTATTTTAGTTA
AAAATTCATCTGAATTAATTGGTAGTTGACATTTTATTGG
TTTATCACATCATCCATTTTACTGCAATTAAAGATTTTTC
AGCTTTGTATCGTTCACACAAAGCACATTCTTTATTTTGT
GTAACAAGAGAATTGGTTATAAAAACCATCCTTTTTCACT
GCATCGAGCTTCTAAGTTTAAAGCGCGTTTAAATACTACT
AGTGGCAGATAATATAGTGATGAAGAACTGGATTTTTTGC
AGTGCGCTGTGCAGTCTGCCAGCAGATTGTCTTATAAGGA
GCTGTCGTTTGGCTTTGCTAGGCGTTTGCCTGGCATGTTC
ATCCGTTTATGATTAAGGCTGTGTGCCTTCTCTTTTTTCG
ACGCTTTTGAAGTGATTGTCTCTTGGTTATTCTCTCTCTG
AAAGCCATTCTCTCACCTCCACAACAGACTGACAATACAT
TTGAGGAGGAGCCTCTCTTATTGCCTGCTATTTGTGTTCT
GACAAGTATAAAGACAATCCCAAATTTACTTCAGTACCTG
AGGCGCCGCGTCCCACTTTCAGCACAAAACCACCATTTAT
AAACACAGAGGCCTTTTTTTTTTTCGAGGGAACACTGAAA
CGTTAAATGTGAGCATTTTTACTTTAAATATACATATATA
CTTCTGTTTTTGTGCTCGAGTTCAGTTTGACCTGCACTGG
TTGTTTCTAAATGATCCGCTCTAAGATGACTTTCTACAGG
GATTATATAAAGCACTTGTACTTCTGTTCACCTTCCCATG
AGTCTCCTCTCTCTCCTGTTCCTCAACTGCTCCAAATCGA
GGCAACTTTTGACTCTTTTTACCTTGAACAGAGAGGATAG
ATGATTGTGTTATTTTTCTTGTAAAACTACATAATGACAC
TTTCAAATGTGTTACTACAGAATGGCGAATGATGGGAAAC
TGTGCCTATTTGTGGTTATGAACCTGGAATTTTTCTTTGT
TGACGATCAACAACACTGGTGTTTCCCTTGTATTTGAAGT
CAAGACTGTAATGTATCTTCAGTCATCGCGAGGTCACTTT
TACCCCCACTGAATGTCATGAACGTGTATGTGTGTGTGCG
CTTGTATCTCAAAGCTTTGCAATACTGAAGTGTCTCTTAA
TGATGTAGAAGATACAGTCGCCTGTTCAAACACGCAGGGT
TATCCACACAGTTGTGCTTTGTACACATATCGCAGCCTGT
TTGTTTGTTGTTGTTTTTTTAAGTTTACAAGATTGTAGTT
TCTTTTTTTCCACCTTGAATTAAGATTTTGCAATATTTTA
TAATCCAAACTCTATTGATATTGCTTTACTGTGAATAAGC
TATTTTTAGAAACAGTGGAATTTAAGCATGCGTATACTCC
TGCAATACAAGAAAAAAATGTTTGTATTTTTTTTTTTTTA
GTAGATGTTTCAACGCTTTTGAGTATTTAACAACAAAAAA
ATGATCATTGTATTTATTTTATGTGTATTTATGTACATTT
TACCCTGTTGGGTACGATTCTGTTGTCTTTCTTTTTGATG
AAAATAAGTTTGGGTTTAATTTTGAGCAGACGGAATTGTT
TTGCATTCCATATTAAAGGACAGGAAAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations