Transcript

ttc22-201

ID
ZDB-TSCRIPT-131113-3718
Name
ttc22-201
Previous Names
  • ttc22-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000054677 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054677|OTTDARG00000038160|ZDB-GENE-050208-292 ttc22|OTTDARP00000042924 ttc22-001 LG_ BX088595.7 Danio rerio protein_coding KNOWN, 2090 bp
ATTATCAGTACGTGTGCAGGACACAATGGAGGACAGCATA
GAAGAAGACATTGAGTCTCTAATTGAAGGAATGGCCTATA
TTCCCGGCCACTTTCATCTGGAGTTAAATCTGAACGGCGA
ACCCAATGGATCAGCTACCCTTCGGCTCCGGGACACCCAG
ATGAAGCGGGAGAGCCTAAGGGCTGAGCTGGAAGCTGAGA
CGGGACGATTGCAATATGCTGTGCGTAATATACTGGGTGT
GCTGGCGTTTCATATGGACGAACTGGAGACAGCAGAAGAA
ACATTTCGTAGCATCTGCCAAGAGGATCCAGAAAACCTCA
ACGCCTGGGCCAACCTGGGATATGTTTATGAACGCCTGGG
CCGTGAGGTGGATGAGGGGGGGTGTGTGGAGCGTGTGGCT
GGCCTCATGGGGCGAGAGATGGGAGAAAACCAAAAAGACT
GCAGGCTTAGGGCAGCCCGGTGCTTGGCTGAACAAGCGTA
CGCACATCCTCATGATGTGGAATTGGAGAGGGATGAAGAT
TTACGCGAGAGGCTGACAGCGGCGCTGATGTTATACAACC
GTGCGCTCGATTATGGAGATGAGCTGATACCGATGGAGGA
AAAAAGAAATTGGTATTTCAAAATGGCAACAATTTACATA
AGGTTAGATGGAATTGTACGGGATTCAAATGACATTGACT
TCACAAGAGTGAACTATTTCAACAAGGGTCTCAAGCTTCT
CACTGAGACTCTAAAATCTGAGAACACGCATCTCAAAGCC
CTGGCCTGGTGTTATATTGGTCTCATGCTGGAGCGAACGG
AGGAGTTTTCCACTGTGCCAATGTCTGTCCATGACTGTGG
ATACTCTGGATCAGACCCTCTGACGTGCTACGGATCGGCC
ATTAAGCTTGCAACGGATGATGCACTCATACTCAACAGGC
TAGCCAATGTGTTCTTCCTGTCAGGCAAACTGGAAATGGC
CACAGGAATCTGTAACATGGCACTCAGTGTTCTACCTGAT
GCTGAACTCAATTGGCAGGCCTACTGCACTCGTGCAAAGC
TTAGTGTCACCAATTATGCAAAGGATCTCGACAAAGCAAA
ATGTGGCCTAGGTAGCATTCCTGACCGTCAGATTCTGAAA
GCAGCCCGTGCAGACCTGGAACGTGTTCAGGCTGTTCGAC
CCTGTTTGAGGACTCATTTGGAGATGGGTCAGATTTACTA
CTACATGGGTGTGGATGCTCTGCAGGAGAGCCTGTTGGTC
GATGAAATGGCCATAAACCAGGCCCTGGTCAGTCTAGCTA
AAGCTCTACAGTGTCCTCTGGGCTCTACAATCTCTAAACT
ACAGCTTCTGAGAGGTCGCTGCCTACTGCTGAAAGGAGAG
GAGCAGAACGCCATTGACTGTTTCAGGAAAGCACTTGAAC
TGGAGCCTCACGGCGTTCAAGATACAGCGATCCTGCGCTG
CCTACTGCAGGCTATTCTCATGAGCTTCACCCAGAGCGGG
AGAGACACGGGTCATGCTATAATCCAGTTAGAGGAATGTT
TAAAGCAGGCGGAAGAGCGATATGGATCTGCTGTAGTCCA
GACTGAGTTGAAGGTACTCTGTCGATCACACACAGATGAG
GTGACGGAGCTCTCAAAAGATTTGGTGAAGAAGGGAAGAT
TGGAGGTGGTTCGAAAGTTGCTGAGGAGTGTACAGCCACA
AGATAAAAAGTATTCACTGGGAAGATCTATTTCTATTTGA
AAGGATCTATGGAAAGTTGACTATTTAATATTCTCTCGGG
AAATTGTTTTATGTGCTTAGGTGGTATGCACATTAAGACG
AGGATTAACAATAATGTAACTATCCATTTCAAACTGGAGG
TATTCAGTTTTGGTAATGCTGAGTGATGGACAAAATGGTT
TTAACCGTATAACTGTGGTTTTAAAGTTGTAAAAGTCACT
TTGGAATGTTGTCTTTTTGGCTTTTCCTCCAGCAACAGGC
CAGAAAGCATGAAGAGCCTGTTAAACTAAAACTTACAAAT
TTGCTATGGGGTTAAAACCACTGAAAGCTTACACTCAAAA
AAGTGATTACTGCAGTATGTTCAGACTACCTGTTTAAAAT
GAGCTGAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations