ZFIN ID: ZDB-TSCRIPT-131113-3613
Transcript Name: epn3a-201
Previous Names: epn3a-001, dkey-120c6.4-001, si:dkey-120c6.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053854 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053854|OTTDARG00000037631|ZDB-GENE-131121-324 epn3a|OTTDARP00000042318 DKEY-120C6.4-001 LG_ BX682552.9 Danio rerio protein_coding NOVEL, 5487 bp
GGTGTCAGGGATTTGTTTTCTCAATGTGGCCTGCCAGTGT
CAGGCTCGTATGTCTCTTTTCGGTGCATAAAGGGTTAAAC
CAGGCGGTGAATGTGCAGCTCGATTCTCCTCCCTCCATCA
GCCTCCTCTCTCGCTCCACTCACTGGCCTTTAACAAGGGT
TCTGTTGCGGGACTCTTTTCGGAATATGTATCAATAACCC
CCAACCGGATAGGCCTGCTCAAAGCGAAACAACAGAAACA
CACTTGCCAAACTTTGAGGTGAACGTCCGGTGTTTTTGAA
GCAGAATTTTAAAACTATCCACACTGAAAACATGCGGAGA
TGTCGAGAGGAGTACAATTGCCAATAGGATCCCAAAGTTG
GGACTTTTATGTCAGGGAATGAGAGGTTAAAAAACTTGCA
GATTTTTATTGCTGGTATCTGACCATTACATCGCTGTGCC
AAACATTGCACCCCATCTTCTCTTCCACCCCATCCCACAC
CTAAAAAACCATCATGACGACCTCTTCGTTACGAAGGCAG
GTCAAAAACATTGTAAACAACTACACAGATGCTGAAATCA
AGGTCAGAGAGGCAACTTCCAATGACCCCTGGGGTCCTCC
TTCCTCACTCATGATGGAAATCTCTGATCTGACCTTCAAC
GTGGTGGCTTTCACCGAGGTCATGGGCATCATCTGGAAGA
GGCTAAATGACCATGGCAAGAACTGGCGGCACGTGTACAA
GGCGCTTAACCTGCTGGAATATCTGATCAAGACTGGGTCA
GAGAGAGTGGCCCAGCAGTGCAAGGAGAACATCTACGCCA
TCCAGACCCTTCGGGACTTTCAGTACATTGACCGGGATGG
ACAAGACCAGGGCATGAGTGTGCGGGAAAAGTCTAAGCAG
CTGGTGGCTCTGCTGAGGGACGATGAGCGGCTCAAGCAGG
AAAGATCGCAGGCACACAAAACCCGTGAGCGTGTTACAGG
GAGCACCAGTGCCATGGGTTACGGGTCTTTACCGCCACCC
TATCCGGGACGCCACCCTAGTCAGCCCAGCATGCAAGCAG
TTCATGTGGACGAGTTTGCCAGGCCTAGGGACTCACCAGC
CTCCTTCAACTCCTCGTCTTCCTCCCCTCATCTGGCCCCA
GATCTGGAGCGGGCCCGTCCTCAGACCAGTGGAGAGGAGG
AACTTCAGCTACAGCTGGCCTTGGCTATGAGCCGAGAGGA
GAGCGAGAAGACCCATGAATCTGTTCTCCCCCAGCCGACT
CCAGCTGTGGATATTGATGAACAGACGCAGCTTCAGATTG
CTATGAGTCTTAGTAAGGAGGAGACACATAAGCCTACTCC
TCTTCCTCCTCCCCCTCCTCCTCCTGCTGCTGCGGTTATG
GAGATGGATGAAGAGGCACAGCTTCAGCTCGCCCTCACTC
TCAGTAAAGAGGAACATCAGCAGGAGGAGAGGAGCCGTCG
GGGGGATGAGTCTCTGCTCCAGAAAGCACTTGAGGAGAGC
AAACGAGAAATGGAGGCCAAAGGAGGATCTGCCATGCTGG
ATCTTGCAGATATTTTCACTTCGGCTCCTGAACTGCCCTC
TGCTGCCAGTGCTTGGGATTCATCTGGAGGCCAAGGTGCT
TTAGCGCAGGCTGGTCCTCTGCGGTCTGACCCATGGGATA
GTCTAGAGCCCAGCTCTTCAATCCGCCGGCATGGAAGCTC
ATGGAATGCACCTCCTGCATCAAGTGAATATTCCCAACCC
TGGGCACATCGACAGCAAACTTCTGACCCATGGGATGCCC
CTCAGAATGCCTCCAGCCCTGTGTCCACGAATCACACCTG
GATCTCCCCTGCACATGGGGCTGGAGTGGATCCTTTTTCT
CCCCCCGTAGTGGACAGACGAGGATCTATTGGCCCTCTCA
AAACTTCACCCCCTCGTGCAGGAAGTCCCTCAGATGATGA
TCTTTTTGATGAGGCTATGGATGGAGGCCAGGCAAATGTG
AATGGCCATGGTAGTCCTGAGCCTTTCAATTTGTCTTCCC
TTGGCGAAGGTCTACCAAAACCAGCTCCTCGAACCTGCAG
TACTCCTGAGGCATTTCTGGGTCCATCTGGAGCTTCACTT
GTCAACTTGGATTCTCTGATACCCCCAAATCCTACTTCCA
AGAACTTCAACCCATTTTTATCAGGAGTGCCTGCTCCGAC
AACCTCTAATCCATTCCAAAATGAAGCACCCCGCCTGACG
CTTAATCAGATGCGTCCCAGCTCCACGTCTCCCGCACCCT
CATCACTTCCATTCAATGCGTCTCTGGCCATGGCATCCAG
CCAGCAGCCCAGCTCTTTGCCCAACACCTTCACACAGTCT
GCACAGGTGATGCCGCTGATCCCTGGACCCCTACCGCAAC
CACTGCTACCACTGTCCAGCAAAACCATGCTTGCAGATCC
AGATACACACAATCAGAACCCGTTCCTCTGAAAGACTACA
TCCAAAAAAGGACTGTTTAACTACCGAATGACTTAAAACT
GGAACACATTTTTAATGGCTTTGCTCATTTCACAGCCTAA
AGGTTTTGCTCTATGCAGTTGCTCTCAAGAGGCATTCACA
CATACATTGTTTTTTAATTTACAAATATACTTATTTTTAA
TAACAACGACCACTGGTAATGCTTTGTGGTTGTATCAAGT
GGTTAATTTGAATGTTATATAAATGATCAGTTATGCAACG
CACACATGCACAGTAGCAAACACATGATCTAGCATGTTCA
CCTGTATAGTTGGCCTAAAAAAAACATCAACATGGGGCAG
ACAAGTAATAAAGCCAACAGCTACACGTTACGTTAGAGCT
GTGGCAAAAAAAATAGTGCAAGAAATCTATTCAGCATTGA
TTCTGAGCTTAGTTATTAACAGCAGATGGTGCTCTAGACC
AGTGTTTCTCAACCACGTTCCTGGAGGACCACCAACACTG
TATGTTTTGGATGTCTCCTTTGTCTGTCACTCATTACAGG
TCCTTCAGTCTCTGCTAATGAGCTTATGATCAGGATCAGG
TGTGTTTGGTTAAAGAGACGTAGAAAATGTGCAGAGCTGG
TGGTCCTCCAGGAATGTGTTTAAGAAGCACTGCTCTAGGC
TTTTCTTTAACAGCAGATGGTGCTCTAGGCCAGTGTTTCT
CAGCCACGTTCCTGAAAGACCACCAACAACACTGCATGTT
TTGGATGTCTCCTTGGTCTCTCACACTCATTACTGGTCTT
TCAGCCTCTGCTAATGAGCTTATGATCAGAATCAAGTGTG
TTTGGTTAAGGAGATGTAGGAAATGTGCAGCGCTGCTGGT
CCTCCAAGAACGTGGTTGAACAACTCTGCTCCAGGCTTGT
TTTCAACAGCAGAATTCACTCAAGGTTTTTTTAACAGCAG
ATGGCGCTCTAGGGTGGTTTTCAACAGCAGATGGTGCTCT
AGGCTATTTTATTTAACTGCAGATGGTGCTCTAGGCTGGT
TTTTTACCATGCACTCAAATAATCAAGAGGAAGAGCTCGG
AGTCATGGAAATTGTTTTTTAGATCTCAAAATTAATGCAA
CAACAGCTTACTGTGAACACTGAATAATTTGTGTAAACAT
TTCCTAAGCTTATTAATGATTAATTTAGGTTCAAGCTTTA
TGCGTAAGAAATTGGATGCATCTGCTGTTAAAAATTAGAC
TCAGAAGCAATGTTGAAATTGTCAGAATCAATGCAGGATT
GATTTCTTGAACAGTGCTATATTGCCCATACATTCTGCAT
TCTTCAGAGATGAAGTCAATCTCAATCTATTAGGCATTCA
TAACGGAAAACTCAAAGAGCTTTAACTGCAGGAACACACT
TGAAAATGGCAGAGGGAAAGTGCTGAAAGAAGTTCACAAA
TGTCTAAAAGCAAAGTGGAACACAGCCAATGTTTGCCCTC
TTCATTTGGTTTTTATTTGCTTTTTTCTCCCCTTACATTT
TTCTTCTTTTGCTTAGATGAAATGTTGTTTGGTTATTATT
GTTGTTGAAGTTCATTAAACTTGTTTAGTCAGTTTAAAAA
CCACAAATGTTTGGGACAAAACAGCTTTATAGTAATAAAT
AGAAAAAGTAACAAGTGGAAAAGGGGCTCTATGCACAGGG
TGTGCCCAAACCCGCCAAGAAAACTTATAGTGAAAGCGAT
GGCCTGACCATCTTCCATTTCATGTGTTCCATTGAACAGC
AACAATAGTATAATATAATCACAATCCAGTCAGTTAAATA
GACCCAAGTATTTATTTAGTTGTTCAAGCATAATGAGACA
GAAATACATTTAAATTTAGGCACCATATGAATGAAGCACG
TTTCCATGTAGTGAGTCAAAGAGAACAAAATAATCACTTT
CTGATAAACCGCCTCCAAATATCGAAAAGAAGAAATGTAA
TTGTAATGTAAATGTATTTTATATAGAATAAACAGTGGAC
CTTTTTATATATAGAATAAATTACTTGTGCCTCAGAAGAT
GAAGACGGAAATCAATAAATGTGCGGTGGCTTTGGGAGTT
GGTAATTTAGGGAGGTTATACTACGAACCACTTTGATGAT
GAACTCTGGCTAAGAGATTTTAAATGACCAAAACCACATC
TCAGCTATTTTACAATGTGGTACACAAAATCACGACTTTT
TGATGAGCATGCTAGAATTTATTTGGTAAATTTGGTACCA
TCATTGTGTGCAATTTTTTTCTTGTCAAATTAAATTAATC
TCCTAAGTAGATCCTAAACCTACGTTTTCAAAATGTATGC
ACATCTTGGCATTTCCATTAAGCATTTTTATAATGCAAAA
AAAGTAGCAGATGAAAAATTCACAGCTTAGTTTGTCTGCA
CATAAAAATTAAAATTGAATGCAAAGCTTTTCACTGACAC
TACTAACTAGCCTAGCTAGCAATAAGAATGTCCACTATGG
AGTATGTGTGAATCACTGTATGTGTGAATGACCTCCAACT
GTAATAAAATGTGTGAATGTCAACTAGGCATAAACATGGC
AATACAGATGCTGGCTTTATAAGAAATTACAAATAAATGG
CACAGGTTAAAATTATGAATATTTAATCCAAGTATTACAA
TAGTTTGGATAAGAAGCTCTTATTACTTGTTCCAAAAAGC
CCACTGCATAACCCAAGCACAATTCCAAAGCCTCATAGAT
TTTTATCATAATCTTGGATTCCTCACACCAGTTTCTAGCT
CTGCTTTAGTGGTATTTTATTAGCCTGGAGTATCTGATGA
CTTTCAATGCAATCCTTTTATTTACTTGACATGACTGGTA
TCTGTGAACACTGAAGGCATCCGATGGGTCACTGGCTCCA
GTATGAAATGACAGGGACTTTGGGGCCAATAATTTAAGTA
TGATTTTATAATATTGGGCATTGACTGTTGAATGACTAGT
CCTCCAGCAAGAGAATGTACTCACTGTGGTGTTCAAAATG
AGTTGATGCCACATACTAACAGAATGCAAGTACGTGAGAC
AATTGCACGTTGCTTATCAAATACAAAGATGGAGATGAAA
CTAAAAA

epn3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA epn3a-201 5487
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
epn3a-201 Contained in:
[BAC] DKEY-120C6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000053854 (1),  Ensembl_Trans:ENSDART00000156347 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR927347 (1) 539 nt
GenBank:CK674433 (1) 482 nt
CITATIONS (2)