Transcript

si:ch211-66e2.3-201

ID
ZDB-TSCRIPT-131113-3610
Name
si:ch211-66e2.3-201
Previous Names
  • ch211-66e2.3-001
  • si:ch211-66e2.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053842 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053842|OTTDARG00000037622|ZDB-GENE-080226-7 si:ch211-66e2.3|OTTDARP00000042310 CH211-66E2.3-001 LG_ CR354432.6 Danio rerio protein_coding NOVEL, 1232 bp
GCTGATTTAAAACCTTTTCTCTTTAGCTGAGCTTCCCTGA
TCACATACAACATGCTTCAGCGTTTCTGTGGACTCGTTTA
TCTGTCAGCACTTTCCCAGCTTTGCCTCAGAGGTACACTT
GCTAAATGTCCTCTTCAGATCACCCCACAGAGTGTTGTTG
TGAAGTATGGGGATCCTGTTTCAGTAAACTGCAGCACTTC
TGTCACACATATGGGGATGGGATGGGAATCCACTGTGGGA
GGAGTGCCCCTGTCCACAGCCAGTCTGATCACATGGAGAG
TGTCAGAGCTGACAGACTGGGAGATACAGCCACCATTCTG
CTACATAAATTATGGCAAACAGTGTGAAGTAGCTCTCCCA
GTCACTGTTTACAAGACTCCAGACAGTGTTTCCATCAGCA
CTGTGAATCCAACAATGAAAGAGGGAAACCAGTATGAGCT
CCAGTGTGACGTTCACAATGTGGCTCCTGTTCAAAAACTC
ACTGTCAACTGGTACAAAGGAGAAACTCTGGTGGATCAAA
CCAACTTCACTGACACCATCAAGAGTCCAGTCAGTAAAAC
ATCTAAACTCCTGATCTGTCCAGACAGAGCTGATGATGGA
GCTCAGTACAGGTGTGAAGCAGAGCTGAACCTGGGAGAAG
AAGGACCTCAACCTCCTCCTACAAACACATCTGAGCCTCT
CCGCATCACTGTATATTATAAACCAAAACACTCCAATTCA
ACAGAGATCATCAGTTGGAGCAATGATGTCTCTCTAAACT
GTACGGTGAAGGCAAACCCGGCTGCTGTGTACTCATGGCA
CTCAGAGCATCTGACAGAGAAGATCAGCTCCTCAGTGATC
CAGTCCTCCACACTCAGTCCAGGAAACTACACCTGTATTG
CCACAAACTTTCTTGGAGAAGACAAAAAAAACTTCACCAT
CAATTGCGTTACAGGTTGTCATGGTACATTCTGGACTGTT
CTGGTTTTCCCCCAGTTGCTGGTTGCATTCACGTCTATCT
TGTAGGAGAGAATTAGTCCCTTATGCTTTATTTTCTCAGA
AATGGGATTAATCTGCAGGCCATTCATGTGAATTTTGTTA
ACTTCAAATCAATTACGTCAGGGATGTGAATGATATGCTA
CACATCACTTTTATTTGTAAATTCAGTTGTGTTTTTTGTT
GTTATCAAGAAGTATTTGACCGTCAAAGTGAATTTGCAAT
TAGACATTTTTTATATTCTTGCCAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations