ZFIN ID: ZDB-TSCRIPT-131113-3586
Transcript Name: si:dkeyp-21h4.2-003
Previous Name: dkeyp-21h4.2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053373 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053373|OTTDARG00000037407|ZDB-GENE-131121-520 si:dkeyp-21h4.2|no_translation DKEYP-21H4.2-003 LG_ BX120006.15 Danio rerio processed_transcript NOVEL, 539 bp
CACCTCCTAAAACAACGGCTTCCGGAATGTCTGCAAGTGT
GAGGAGGGCTGGAAAGGTCAGATTCAGATCACCCCGAAGC
AGGACAACTCCAACCATCTGGTCTTCAGAAGTGTCTGTGC
ACACATGGAGCCATTAGTTCCACTTCTGGCTGGACCTGGA
CCTAATCCTGCCTCTCTCTACAGTCTTCAGGGGCCCGTGG
GGGCCACCCAAGAGACCCATAACCACAGCAGCAACAAATA
CCTCAGTCCTTACGTACAACTGCACAAGTCCAGGTGATTC
TGTCCCTGAAAACTCACTTCAAAGCTTTGTGTGTCACTGC
TGCAGCACCTCGACTGACCTCCAGGCAAGCTGGACAGATA
GCCAGACAGAGGGGGGAAAGACAGGAATGACTTGTGACAG
TGAGGAAAAATTCCAGAGGTGTTAGAAGAGGAACAGGAGG
TAAGTTGGTGTCTGGGATTTAATGACCTTACAGCAAACAC
TTCATCCATCAGTTCCATCATGGACAAAACTGGTAAATTA
CACACAACTAAACAGCTAC

si:dkeyp-21h4.2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkeyp-21h4.2-001 (1) 802
antisense si:dkeyp-21h4.2-002 (1) 512
si:dkeyp-21h4.2-003 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-21h4.2-003 Contained in:
[BAC] DKEYP-21H4 (1)
OTHER si:dkeyp-21h4.2-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053373 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR929019 (1) 539bp
    CITATIONS (1)