Transcript

si:dkeyp-21h4.2-003

ID
ZDB-TSCRIPT-131113-3586
Name
si:dkeyp-21h4.2-003
Previous Names
  • dkeyp-21h4.2-003
Transcript Type
antisense
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053373 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053373|OTTDARG00000037407|ZDB-GENE-131121-520 si:dkeyp-21h4.2|no_translation DKEYP-21H4.2-003 LG_ BX120006.15 Danio rerio processed_transcript NOVEL, 539 bp
CACCTCCTAAAACAACGGCTTCCGGAATGTCTGCAAGTGT
GAGGAGGGCTGGAAAGGTCAGATTCAGATCACCCCGAAGC
AGGACAACTCCAACCATCTGGTCTTCAGAAGTGTCTGTGC
ACACATGGAGCCATTAGTTCCACTTCTGGCTGGACCTGGA
CCTAATCCTGCCTCTCTCTACAGTCTTCAGGGGCCCGTGG
GGGCCACCCAAGAGACCCATAACCACAGCAGCAACAAATA
CCTCAGTCCTTACGTACAACTGCACAAGTCCAGGTGATTC
TGTCCCTGAAAACTCACTTCAAAGCTTTGTGTGTCACTGC
TGCAGCACCTCGACTGACCTCCAGGCAAGCTGGACAGATA
GCCAGACAGAGGGGGGAAAGACAGGAATGACTTGTGACAG
TGAGGAAAAATTCCAGAGGTGTTAGAAGAGGAACAGGAGG
TAAGTTGGTGTCTGGGATTTAATGACCTTACAGCAAACAC
TTCATCCATCAGTTCCATCATGGACAAAACTGGTAAATTA
CACACAACTAAACAGCTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations