Transcript

fbxl17-201

ID
ZDB-TSCRIPT-131113-358
Name
fbxl17-201
Previous Names
  • fbxl17-001
  • ch73-368o13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052538 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052538|OTTDARG00000036880|ZDB-GENE-111013-3 fbxl17|OTTDARP00000041295 CH73-368O13.1-001 LG_ CU929327.18 Danio rerio protein_coding NOVEL, 1114 bp
GCGGATTATGAGAGCCCGGGACGGAGCTGCTGAGGGCCGC
GTGAGCTGAGTCACCGTGAATCATCTATATGGGCCATTTT
CTCTCCAAAAATGGTTACGGCCTGAAGAAGAAAACACGGA
AGCTGCGCAAGAAGAAGAGGCGGAGGAACTGCTTCCTTCA
GGGGCCGTGCATGCTGTGCTTTATCGTCCACGGCTCCAGC
GGGACGCTCGAGGACGATTGGCCCTTCGAGAGTGGCTGTG
CGGCGGCCGTGTCCAAACTCGCAGAGCGATACGTTACCTT
AAACTCCCCAGAGGAGTGCGCCAAGTTCCTCCTCTCTCCG
GTGTGGGAAGGCCAGGGTCGAAATCTGCTGTCTGCCGTGC
CGACTAAGCTGATCGGGCCCCCTGCGCTTTTCTGCGAATA
TTCGGAAATGGTGTGCAAGCGAAAGTGTGCTGATCTGCAG
CGGTGTTCGCCCCGCAAGCAGCCGCGCTGTGCCTTCCCGG
GTCCCATGGAGAACGGAGAAGAGCGAGGGGACGCCGCCGC
TCCAGACAGCCACTGCCTGCTGCCCTCAATCTGCCCGCTG
CCTTCATCATCATCATCATCGTCTTCCTCGGCTTCAGAAG
AGGATGGAGCGACTGCAGGACGGCATTCAGATCCTGGCGG
TGCCACGACCTGCTCATCGTCCTCCTGCTGCTGCCAAACA
GAGGCTTCAGAGGAGATAAAGAGCACTGAAAATACAGACA
CGTCCCACATCAACCAGCTGCCCTCCTCCATACTGCTCAA
GGTGTTTTCTCACCTGTCGGTGAAGGAGAGATGTCTGGCT
GCCTCTCTGGTCTGTAAATACTGGCGGGATCTCTGCTTGG
ACTTCCAGTTCTGGAAACAGATCGACCTCAGTGGCCTCCA
GCAGGTTAAAGACGATCTCCTGGTGAAGATTGCATCACGG
AGGCAGAACGTCACGGAGATCAACATTTCGGACTGCCGTA
ACGTTCAGGATCACGGCGTTTGTGCTCTGGCGTCCAACTG
TGCCGGTCTGATCAAATACACTGCGTACCGCTGTAAGCAG
CTGAGCGACGTGTCTCTGAGTACGGTGGCCATCCACTGCC
CGCTCCTGCAGAAAGTCCACGTCGGAAACCAGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations