Transcript

mpped1-201

ID
ZDB-TSCRIPT-131113-3515
Name
mpped1-201
Previous Names
  • mpped1-001
  • ch73-375o18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052220 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052220|OTTDARG00000036642|ZDB-GENE-111104-1 mpped1|OTTDARP00000041043 CH73-375O18.1-001 LG_ FQ311921.4 Danio rerio protein_coding NOVEL, 1433 bp
GAGTGTCTCCTACCGTAATACACGCACTCGGACACACGCA
CACACACAAACCGGGGCACCACGCGACTCCGGTTCAAACA
AACCAGCGCGAGCCTCTGCAAACAGAAGACACAACGTTTT
CACGCTCTCCCCGGTTATTTCTCAAGTATTTTTTAACCTG
AAAACCTGTCTTCGTCAGACTGCTGAGTTAAAGCAGGTGT
ATTGTGTCCGCTGGTGTATTGTGATTGAGGGGAAGCATGC
AGATTCAATATCCCAGCAGCAAAGCCATACGGTGGACCAG
CCACTGAAGACGGTCCCTAAACTGTCCCAAAGACTTGCAC
AAGACATCCAAAAGTGGAATCCCTTTAAACCAAACACCTA
CGGACAAGTGTGGGTGTGTAAGAAACAACAGAGACAGTGT
GTGTGTGTGTGAGTGTGTGTGTTTTGCCATGGCCTTCACA
CTTTCGGAAATCATGGCAGCCCGACGACAGCAGCAACAAT
CTCAGAGAGGAGGACGAGGAGTGGTAGAGGTGGACGAATA
CAGCGCCAACCCGACTCAAGCCTTCACTTTCTACAATATC
AACCAGGGCCGCTTCCAGCCACCCCATGTCCACATGGTAG
ATCCTATAGCCCACGACACCCCCAAACCCCCGGGCTACAC
GCGGTTTGTCTGTATCTCCGACACACACTCGCGCACTGAC
GCTATTCAGATGCCGTACGGTGACGTCTTACTGCACGCTG
GAGACTTCACAGAGCTCGGCCTGCCCAGTGAAGTCAAGAA
GTTTAACGACTGGCTTGGCACTCTGCCCTACGAGATAAAA
ATCGTCATCGCCGGCAACCACGAGCTGACGTTCGACCAGG
AGTTTATGGCCGACCTGATTAAGCAGGATTTCTACTACTT
TCCCTCAGCCTCCAAACTCAAGCCGGAGAACTATGAAAAC
GTGCAGTCGCTGCTCACCAACTGCATCTACCTGCAGGACT
CTGATGTGACCGTCAGGGGCTTCCGCATCTACGGCTCACC
CTGGCAGCCATGGTACTACGGCTGGGGTTTTAATCTACCA
CGAGGACAAGCTCTGCTGGACAAGTGGAATCAGATCCCAG
ACTCAACGGATATTCTTCTCACACACTGCCCTCCTCTGGG
GTTTTTAGACTGGGTGCCCAGAAAGATGCAGCGTGTTGGC
TGTATGGAGCTATTGAACACCGTCCAGAGGAGAGTTCAGC
CCAAACTGCATGTATTTGGACACATTCATGAAGGCTACGG
TGTGATGACTGACGGAACCACCACATTTGTTAATGCCTCT
GCGTGCACAGTGAACTTCCAACCTATGAACCCGCCCATCG
TTTTTGACCTGCCCAATCCCCGGAGCTCATGATTGAACTA
AGACCCGCCCCCTTCCTTTAATCAGGGTCTCGTTTTGAGC
GTGTACGGATGCTGTGTTGTGTATATAAAGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations