Transcript

tapbpl-202

ID
ZDB-TSCRIPT-131113-3507
Name
tapbpl-202
Previous Names
  • tapbpl-001
  • ch211-234a4.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051889 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051889|OTTDARG00000036448|ZDB-GENE-121003-1 tapbpl|OTTDARP00000040772 CH211-234A4.6-001 LG_ CU104697.13 Danio rerio protein_coding PUTATIVE, 4755 bp
AAAACAATACTCACTTTTATTTTGAATCTGCCAATGAGGA
AGAACGGTGATCAAAAGTGAAAGTGCAGGCTAGCAGCACC
TTCTGAAAGCATCTCTGTTCGGTTTCGACGTTGGTATACC
GAGAGCCGCTTCATGTCTCTGACTAAAATGCGTGTTTGTT
CAGTTAATATATGCAGATAGTAAGCGACATCCAGCAAAAC
TACAGTATTAGTTGTCTTGTCAGCAGCTGCTCGGTGATGT
TAACGCTCCTCGTCTCCCTTTCTTTGGTTTATGGTGAGCT
CTGTTTATTCGTGTGTTCCTGCCTTGTTTTCGGTCGGTCT
GCTAATATATGTACATAGATAGATTAAATATGAAATAATA
TAGAATTACTTTACTGTCTTACGTAGTTAAAAGGAACATA
TTAGATTTGCTTTCGGTTTTATTTTCAATAGTCTGACTTT
GGTAGCTTTTGGCTCCTCCTGCTGTTGTGGTGAACGTACT
ACTGTCGTCACAGGGCTGGATGGTGCTGATGTGGTTCTGT
CCTGCTCTCTGATCGAGGAAGGGGGCGGGATGGGCGGCAT
GGGCGGCATGATGGGAGGGGCGATGTTCAAGCGCACTCCC
GCCACTCTGGTCTTCAGGGATTTTGTTGAGAATGAAGGTC
TGTCACCAGAGCTTGTGACCCCCTATAACCCTCCTGAGAC
CCCTAATCCCGAGGATCTCATCTTTGAGTTGATGTTACCA
TCCATTCAGATCCCCAACGCAGACTTGCTTCTTCACGCTG
ACTGTAATGAACAGGAAGTGGTTTGTGAGATCAGCCGTTA
CGTTCCTCGCGGAGCTGATATGGATTCCCTACCAGCTCAT
TTTATTGGCTCAATTCAGCTGGAAGGTGGAGGCATCAGCC
TCACTCTGGTGCTACAGACCCTCCACAGTGAGACCACACA
ATCTGATGCGCAACCACTTATGCAGAGTAAACTGAATCTG
CCTCTCAGCCAATCAGCAACGTTGCTGACAGAAGTTGTGT
TTGTGGTGTTCTCTCGTGTACCATCCATTGTGGCATTAAT
AGGGGGTGATGTGATGTTGGACTGTGGCTTCAGACAAAAA
GAGTCTGTCCCTGGGCAGGATGTGGCTCTGGAGTGGCGCC
TTCAACACAGAGGAAATGGCCGTAAAATTCTTGATATGAA
GGCAAGGGAGATGGAGACAGAAATAGGATCAGATGTATTC
GTGGACCGGGAAAACACCAGCACTGAAGCAGATCTTCTAG
TGAGGGATGGAAATGCCTCTCTAACTCTCAGGACATTGCA
GGTCTCAGATGAAGGCACATACATCTGCACCGTGGGCTCT
GGAGACTTTCAGACTCAACAGATCGTGCAGCTTCACATTA
CACAACCGCCTCGCATCACACTTTCTGAGGAGAAGCTGTC
ATTTCCGGATAGGACACCTCAGAGACTTAGCTGCCATTGC
AATCGCTACTACCCTCTGGATGTGCAGGTGGAGTGGTTTT
CACAGGCTCCGTCTTCAGAAGAGTCTATCTCGTTGTCTAA
GGACTCCTCGCTCTCCAGTCATCGGCAGCACAGTGATGGA
ACATTTTCTGTCTCTTCTCACCTCACCCTGTTACCAGACA
AACACCCACCGGGGACTGTTGTCACCTGTAGAGTCTCACA
TCCCTCCCTAGAAACTCCAACTAATGCCACCCTCACTGTG
GAAGAACCTGAGCCAGATACAGCTTTCTGGACAATAAGCT
TGATGTTGCTGATATCAGTGGTGTTTTTGTATCAAGCGTT
TAAAGGTGGAGTGTTTTAAGAGAAAAGCAGCAGCAACCTA
CTGAAAGAGGTCTTGGAAGGAACCATTTTCGTTATTTTGA
TTTGCCTTTTTCTTCATCCGTCTTTAAAATGGATTTGTTT
CCCTCAGTCATGGCACATTTGTTTAAGTTTGAGGTTTTCT
GTGTGGCTTATTCAGTAAAAGTAAAACAACAACAAAACAA
AAGATGATTTTTAATTGTAATGTTTTGATTGTGTAATGTT
TATGTGTTGTACATTTTATTTGCTTTAGTGAACGAAATAA
AAACAGAAACAGAGATGAGTTTTGTTGAAGGTTTTATTCA
GGGGCATATAAGCATGCGGTTTATGCCATTAAAATCTTCC
AGTGGCTGATTTTACCCCTCTGTTAGCCCATACACCCTTT
CATTCATTCAGATTTATGCACATAATAAATAAAACATCAT
ATACTTTGCCTTTGTTAACATTACAAAACAAGAATACACA
TATAGAAGTTCTCCAACAACAAAACTAAATATAAAAGACT
GTGCTGAGGAAGGAATGTGAACCAACAATAGTAAGGAATG
TGAAAACCAACACTTACATATTGCATGGCAGTATAGACTA
TTGTGTAGGCGTTTCTGCATTGATTATCTGGTCACTTGTG
TATGTTTCAGTACATTTTGGCAGGACTGTAGCATTCATGT
CTTGTTCCCAGATTAGGCGTTTTCACAGAACAGGTAATTG
AGGTTTATTTTGTTCTTAACAGGCAGTTAATAGTAATAAA
TCAACAAGTCTAACAGTGGATTGTTCCGCCATGCAAATCA
GGGGACATCAAATCAACTTCAAACACCTTAAGCCTTCTAT
TTTACCCTTCATTTCATTAAAAAAGTTGTGTCGAAAAAAA
CAAGAGTTTTACAGAAAAGTTTTACAGAGTGTGAAAACTA
CTTTGAATTCGAAACAACCGTTTTTACTGTAAACTTTTTT
TACACGTTTTTTGTTGTTGTTGTTGTTGTTGTTCATGGTT
GTTAAAGGATTTTAATGGGATCATTGATGCCATAAACACT
CTTAAAAATAAAGGTTCCAAAAGGACAACTTTTCTTTGAA
GAAACTAATAACAATTCTTCAAAGAAGCACTTTTATTTCT
AAATGACTAAGATCTAAAGATTCCTTTTCCACTATAAATA
ACTTTTTTGTTTTGGAAAATGGAGAGGTTCTTTAGAGGTT
AAAGGTTTCTCATGGAAACTATTAATAACAAAACAATAAT
GCCAATGCAATGGAAATAATCTAAATATGTGTAGGGATAA
GCTAGTCTAAATTTGTAGAATGTCAGATGGAAGGTTTTTT
TTCCACACACTCATTTTTTTTATAAATGCTCAAACATTCT
CTGTTTTACATACAATACCACTCAAGAGTTTGTTATTCAA
ATATTAGCTGATATTGGTATTCTCATATAGTCTAAACAGT
AATGAGTAAACAGCAAATAATTATTTTGGTTGAATCAACT
TTATACTTATCATCAGTGATCTTAACTTACAACAGTCAAA
CTGACTAAAGATTTAAAGTTTGAAGGTAAACTTTGACTAA
AAATGTTTAGCTGAAACCTGATGAATGAATGTAACACTGA
AGCATTTGTTGTCATTTCAATTTTTAGAGTACTGATATTT
CATATTTTCTTTCCACCTATTAGAAAAACCTAGAGGCTCA
GCACACACAAATGAACTAATTTACACTAATTAACACACAA
GCAGCTGTAAAAAAATAAATAAATGAAGCTGCTGAACATA
TATGAGCAGTAGGCAGTGACCTATTTTCTGCATCTTAAAT
CCTTCATGCTACATGAAACTCTTCTTTTACATTTCTGTTG
TGGAATCGAATACATTTTATTAATGAATTTAATTCATTTA
TTATTGAATTTCAAAATTTTTAGTTGTAGTAATTGTATGT
GTCATTCTATATATATAAATTTATTATTTACAATAATTTA
AATTGTTTTAGCTGTAGCTTTACCAAAAACAACAATAGTC
ACAATTAATAAATGTAATAATTAATAATAGCTGCACTTAT
TTGATCAAAAATACATTCGTTTTTTTTCAATCGTTTTGCT
ACAAATTTCAGAATCCAGATGTCAATTTTCAAAACTCTAT
AAACACAAAATTTACAACCATTGCCAAAATCGCACGTTTT
TACAAAACTCTTAACTCTTTTTTTTTTTTCAAATGCTTGG
ATACAATACAAAAGTCAAATATACTTTGTTCAATAAACTA
AACCCCCCTTTACAATATAACACAATTGAACCAAATTGAT
CCCATTTCCAAAAGCAACTCAAACATTACATTTGAAATAA
CTGTGCATTAATTAAATCAACACGATGTAACTATCAACAG
ATACAAGTGCTTGAAATAATAAGTAACTGCTGCATTACTC
TTGATGCATGGATACTGATGTACAACATTACATATTTAGA
TGATGAAAGTTTTAGGATAGGCATCAGTTAGCACAGAAGA
TGACCCAAAAAGACACCATCATCTATTGATTTCATCCTTA
TTCATCCTTATTCCTCATATATGAGTTCCATGTATCACTT
TTACAATGTATTACAGGCATGCAGAGTTTTGAGCACTGAG
AGTCTGTGTTAAAAGTGGTGACTGTTTTGAATTTTGAAAA
TTGACATCAGGGTTCTGAAATTTAAAGCAAAACAATTGAA
AAAAAAAAAAGATGTTTCTTTTTATATGCTAATATCGTAA
AATACTTTTAACAATGCAAATGAACAATGTTTGGTTTCAA
TATTGTTTAAAGCTGGTAATATTGATTAACAAATATTGTG
TAACATTTAATTGATGAATTTTACTATAATCTGACATATT
ACATATTACAGAGACAATACTATCTGCGTCATAGTTTTGT
GTAAAATAATAGTAATTGATCGGTTTGAATGTAACTTCCA
AATTTTATTAAAATCTGTATGAAATCAAGGTTTGCCATTT
TAGAGTCATGATATTTTTAACCACCATTAGTTTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations