ZFIN ID: ZDB-TSCRIPT-131113-3502
Transcript Name: zgc:109949-201
Previous Names: ch73-348n11.2-001, zgc:109949-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051847 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051847|OTTDARG00000036416|ZDB-GENE-050522-166 zgc:109949|OTTDARP00000040739 CH73-348N11.2-001 LG_ CU695216.16 Danio rerio protein_coding KNOWN, 1567 bp
CAGATTAAAGACGAACACAGATGAAAATGGGCGTGTCCAG
AGTTCTGCTTGGCCTCGCCCACCTGACCAGTCTATTCGCT
GCTGTGGTGATGAGTCACGAGGGGGCGTGTCTTCGGGATG
GCCGACACAAAGCCACACCCTCTCCAGAGCGCCATCTGCA
GGAGTGTTCGCTCTACACTGAGAACTCGTGTTGCTCTGAA
ACGGACATCCAGGATCTGTCTGTCTCTGTGTCCACGGTGG
AAAACACTCACTGGGATAAATGTGGTGTCCTCAGTCCTCT
CTGTGAATCCTTCCTGAAGCGCGTGGTCTGCTTTTACCGA
TGTTCTCCTGATGCTGCTCGTTGGCCACACCCACATCAGG
GCTCCTCCCTGAAGGCAGTGCCTCTGTGCCACAGCTTCTG
CAGAGACTGGTTCGAGGCCTGTAAGATGGACATGACGTGT
GCTCGTGACTGGACCACTGACCCACGCGGACAGAACTGCA
CCGGCGCATGTGTGCCGTACCAGCAGATGTATCAGCATGG
CCGGGATCTCTGCGAGAGTCTTTGGGGCGACGCGTTCATG
ACTGTTGAAGACGACCCCGGTGAGGAGGACGGAGTGGAGG
GCTCCAGCTGCGGCTGTCTGACGCTCAGCCCTTCAGATCG
AGAGGTGATCGCGGCGCTGAGGGTTCAAGAAGGAGACCCT
GAGGAGCTGGACACCACTAAAAGTGGTCTGCCGCAGTACA
GGGCGCCGTGTCCTCCAGCGCAGCCTCAAACACGCAGCGC
CACAGCGCCACCGCAGGCGCGGAGGAGCAGTGTGAGCAAC
GGACTGCGCAAACGCTCCGTCCTCGCCACTGATATGGAGG
GAAGTGGAAGCGGATTTTAGATTATTATCTGTGCTTTAGA
TCTGATGAATGTTTCTTAACCCTTGTGTATTGTTCAGATG
TACTACCCTTTCGTTATGTTCGGGTTTTGCCCCAATGACT
TCCATTTATAATGACGCTTTTTGATTGCAATGCCTTGACA
CCATACCCAGCAAGCATTTTTTTGTTTTTAATAGATGTCT
AATAGATGTTTGAACTTATCTTGGCTAAAACAAAGATAAT
TTGGGGCTGTCAGTGAAAATAGATGTCTCAAAATAAGCCA
AAGCTAGACTAGTCCTGAAATAAACAGAAATGATTGACTA
CACACATTAAGTCTGTCTAATCCAAAGGTGTCAAACGTAT
GGCCCGCAGATGATTCTGTAAAGTATAAAAATGAGCTGCA
ATTTTTCAATAAAAGAAACCGCTGTTCCAGTTGTGTCCAC
TGGATGGCGCAATAGCAGACTATTAATTTTATCCGATCCG
GAAGACTGAATAAGCGTTAGTTTGACAGCCTTCTCAGAGA
GAAAGACCACATCTATGCCCTGCCACACCACACTAAGGTG
ATCTCTTGTGGAAACGTAACAAAGGAGGCGTGGCAACCAA
CCACACCCCTAAACTCAACCATCATTGGTGGATGAGCAAA
TCCTACTAAATTGTACGAATGAGATTGTACGTCGGTCCCC
ACTAAGTTAGGGACCACAAATCTTTTTGAGCAAGTAATGA
GCAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:109949-201 Contained in:
[BAC] CH73-348N11 (1)

Genome Resources: Vega_Trans:OTTDART00000051847 (1),  Ensembl_Trans:ENSDART00000165551 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095075 (1) 1615 nt
CITATIONS (2)