ZFIN ID: ZDB-TSCRIPT-131113-3470
Transcript Name: aldh3a1-201
Previous Names: aldh3a1-001, ch211-87m19.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051040 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051040|OTTDARG00000035822|ZDB-GENE-120823-1 aldh3a1|OTTDARP00000040117 CH211-87M19.1-001 LG_ CR848784.13 Danio rerio protein_coding NOVEL, 1827 bp
GCTGGCTTGACCGCAGTATAAATGCGGCTCTTTTGCTCCG
GGTCTCCGCTACGTCACCTCAATGGAGCCGTCACAAACAC
CCCAAACAGCGTTCCTGTTCTGAAAACAGTTACGAACTGT
TTTATGAAATTCCTAATTCAGACCTGTACAAATGGAGAAG
CAGGTTGTAGATGGATTAAGGGAGGTCTTCCAGTCAGGCA
GATCCAGACCCCTGCAGTACAGAAAACAGCAGCTTAGAGC
TCTGCTCCGGCTCATCACTGAACGCCATGCAGACATTGAA
CAAGCTCTAAAGCAAGACCTTAACAGGAGTATGCATGGCA
CTTCACTCTTTGAGTTGATCGGCATTGAGAATGACATCAA
GGTGGCAGAGCGTGAGATGACAGAGTGGGCAGCTCCTCGG
CCTGTGAAGAAGAATCTCAACTCCGCACTTGATGATGTTT
ACGTAAAGCCTGAACCTTTAGGTGTTGTGTTGATTATTGG
AACCTGGAACTATCCTTGGGCCATGATCTTTCAGCCCCTT
GTTGGAGCTATTGCAGCTGGAAATGCGGCTGTGGTGAAGC
CATCAGAGCTGAGTGAGCACTCTTCTAGACTAATGAAAGA
GCTGCTTCCTCTCTATCTGGATAAGGAGATGTATCAGGTG
GTGACAGGAGGGGTTCCAGAGACCCAGGAGCTGCTGAAGC
AGCGTTTTGACCACATCTTCTACACTGGAAGCAGCACAGT
GGGCAAACTGGTTATGGAAGCAGCTTCTCGTCACCTCACA
CCAGTCACTTTAGAACTGGGTGGAAAAAGCCCCTGTTATA
TTGACAAGAACTGTGACATTGCTGTGGCGTGCCGACGAAT
AACCTGGGGAAAGTTTGCAAACTGTGGCCAGACATGCATT
GCCCCTGACTACATTCTGTGTGAGCCAAGCATCCAGGACA
GGATAGTTGAAGAAATTCAGAAGACACTTCTGGAGTTCTA
CCAGACGGACCCTAAAAGCTCTCCAGATTATTGCAGAATC
ATTAACACACGTCACTTTGACAGAGTATTGGCTCTGATGA
ATGAATGCACCATTGCTTTGGGAGGAGAAAATGATCGCTC
ACAGTGTTACATAGCTCCTACAGTCCTGAAAGATGTTTTG
CCCCATTTCAAAATCATGCAAGAAGAAATCTTTGGACCCC
TGCTGCCCATTGTCACTGTTAATGGCTTGAGTGAGGCCAT
AAATTTTATCAATGCTAGAGAAAAGCCTTTGGCTCTCTAT
ATTTTCTCCTCTGATAAAACGGTGATAAAGAGAATGTTAA
AGGAAACCACCAGTGGAGGAGTGACTGTTAATGATGTCCT
TATGCATTACACTGTTGATACTTTACCTTTTGGAGGCGTG
GGAAACAGTGGAATGGGCAGATATCATGGGAAACACACGT
TTGACCAGCTGAGCCACCATCGTGCCTGCCTCATCAAGTC
TTTTGCTATGGAGAGTTTGAACGATGCCCGTTACCCTCCA
CTAACAACAGCCCGTCTGCGCAAGGCCAAGTTTTTTATGG
GGCATCGCATGTGTAGCTGTAATGGCATGTGTGTTTGGGC
TGTCATCGCCACCGTACTTGCAATTGGCCTGCTTGTTGGA
CTATTAGTTGTGCTGATATAGGTAAAGGATTTTATTGTAT
TTACTATCACATTGTAGAAATAGTTTCAAGGGTTGATTTT
GTGTTTGCACTATGCTCACATTTTATTACAGTCTCAGGAG
GATGGCAAACCCTAGAGCATTTTAGGGAAGAAAGTCTGAA
CATTGACTCGCCCTCAGGCAATCTAATGTTGTTGATGTTT
TTCTTCATTGAATATTTTTTGATGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aldh3a1-201 Contained in:
[BAC] CH211-87M19 (1)

Genome Resources: Vega_Trans:OTTDART00000051040 (1),  Ensembl_Trans:ENSDART00000154665 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC075877 (1) 1987 nt
GenBank:AF254954 (1) 1980 nt
GenBank:EH454689 (1) 1037 nt
GenBank:EH572806 (1) 928 nt
GenBank:EH551678 (1) 925 nt
GenBank:EH560245 (1) 892 nt
GenBank:EH571495 (1) 795 nt
GenBank:EB978100 (1) 744 nt
CITATIONS (2)