Transcript

plppr3b-202

ID
ZDB-TSCRIPT-131113-3465
Name
plppr3b-202
Previous Names
  • dkey-9k12.3-001
  • plppr3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050688 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050688|OTTDARG00000035600|ZDB-GENE-120514-1 plppr3b|OTTDARP00000039801 DKEY-9K12.3-001 LG_ BX000430.8 Danio rerio protein_coding PUTATIVE, 3811 bp
TTCCACTGCTGGAGGAGATCAGTGCGGATCACTCGCAGAA
GATGCTCAGGAATGCTGCCACACCTGATGACTGCTGATGA
TTGACCGATTTTATACACACTTTATCAGTGGATGCAGCAC
TGTCAAATCATTTTTATATCACACTGTGGGCTCCTTCTGC
TACCGAAGCCCCACAGATATCAGACCCCTGACTACAGAAG
AGCAGTAACAGCAGCTCGGTGAGTTGAGAAATATTATGGT
TGGCTCCACATAACAGGAGTCCACGGCTGCGTGATTGTTC
CGTGGAAAACGTGAGCTGCAAGAGGAATATGAACTGAAAG
AGCCGCAGTCTAAAATCGTGAGGAACGAATACACTTGAAT
TTTCACTCGGGATTTACAGGGAATCGCCGCTTTTCACAGT
GAAGGCACACCGTCTGTTATCCATTCATTCAAGGGGACTA
CATTTTGTTTCAGATGAGAAAATAATAATTCGAACATTTT
AGTGCAGTCCTTTTCCTGCGAAAATCTTGAGAAGACCACC
ACCATGATAACTGCACGAGAAAAAATCAAGAAGAAACCCC
CCAAAGACAGTCTGACACTGCTACCCTGCTTCTATTTTGT
AGAGTTACCCATTGTGGCATCCTCCATGGTTTCGCTGTAC
TTTCTGGAACTGACGGACGTGCTCCAGCCAGCGCAGGTGG
GATTCCGCTGCCATGACCGATCTCTCAGCATGCCTTACGT
GGACAGTGGCGATGAGCTTATACCTCTGCTTATGCTCCTA
AGTCTGGCGTTCGCTGGCCCTGCTGCCTCTATTATGATGG
GTGAAGGTCTACTGTATTGTATGCAGTCCAAACTGAAGGT
TCGACCTGGGATTGAGGGAAGCATCAATGCTGGTGGATGT
AATTTTAACTCTTTCCTGCGGAGAACTGTTCGTTTTGTTG
GTGTTCATGTGTTTGGGCTTTGTGCAACAGCATTGGTTAC
TGATGTCATCCAGCTAGCCACTGGCTATCACACGCCATTC
TTTCTCACAGTGTGCAAACCCAATTACACTATCCCAGGTG
TGTCCTGTGACAAGAATCCTTACATCACCAAAGACATTTG
CGCTGGGCAGGATCAGCATGCTATTCTATCTGCAAGGAAA
ACCTTCCCTTCCCAGCATGCAACCCTCTCTTCCTTTGCTG
CTGTTTATATTTCAATGTACTTCAATTCAACAATTTCGGA
TAGCACCAAGCTGCTCAAACCTGTTCTGGTGTTCGCCTTT
GCCATTGCGGCTGCGTTGACAGGACTCACCCAGATCACCC
AGTACCGCAGTCACCCCATTGATGTTTACGTTGGGTTCTG
TATTGGTGCCGGAATTGCAGCATACCTGGCTTTCCATGCT
GTTGCCAACTTCAAATCTCCAGAGGACGCTGTGATCCCGC
AACCTCCTCCTCAACAGAAAGATGCTTTGAGGGCTCTAGC
CCAGCGAGGTCACGACTCTGTATATAACAAAGGTCATGCT
TCTGAAAGCAATGAAGAAATTACATCACCAGCATCTCTAG
ATGGGCTAAACAGGCCTGTGCAGCGGGAGAAAACCTCATT
GGGAAGCTTAAAGAGGGCCAGTGTGGACGTGGAGTTACTT
GCACCTCGCAGCCCAATGGGAAAAGAGACCATGGTAACAT
TCAGTAACACATTACCCCGTGCTACAGCTCCAGAGGAGCC
AACAAGGCGTCTGGTGACTGTACCTGTACCACTGGACCCA
ATGCGGTCACAACAATTAGTGTCTGAATGGAAACAAAAGT
CAATGGAAATGCGAGGTGGGAGCTTGCCTGATGAAGACAC
CAGTGATCAGGGCTCAGACGGTGGAGATGACACAACCACA
GAGGAAGATAGCATCCATTCTTCAGTCTATTCATCTGTTC
CACATATGTCTAAACCAGCTAACCCACCTACAGGTCCAAA
AGCAGTGATGACCCCTCGCCCTCCCACACAGTCCTCAATT
CCCCCTCCTGTATCCCCTAAAAGTGCCAGCACTAGAGCCA
AATGGCTGTCCATCACTGAGAAAAGTGGTGCTAATATTCC
AGTTGTCAAGGCAGGAAATCAGCCTCGGATCATGCAGGTC
ATCGCCATGTCAAAGCAACAGGGATTGCTTTCTGGATCTG
CAAAATCCTCAGAAACTTCATCCTCTTCTGGTACTTCATC
GATCACGGGCACAGAATCATCGCCCAATCGCTCGGAACGT
GACGGCAGTCCAGGCATCATAACCGTTGATGCCCATGCTC
CCCATCACCCTGTAGTTCGTATGACCTCCAACCCCAATAA
TCCCTGGGAGTGGAGAGGGTCTTCTGATGGAAACATGGCT
GAGTCTTATGAGCTGAAAAATGTAAACCGTGAGGGTTCCC
GCATTTACCGTCATGTCAGGAGTGGCTCTCCATGTTCCTC
TGCCAGTGAGGCTGACCACGGGCCACCTCAACCCCCACAA
CCTCCCCAGCCACCACTTCCCCCTCAACTTCCACCTGTGG
GGAACACCTCAGAGGCTCGCAGTCTGCGCCGCAAGACCCC
TCTAGTTCTACTTGATAGGGAGGGCAATCAGAACCACACT
GAACAGGACAACTACTACAAAAAACTACAAAGTGGCAGGC
ATTTCTGAGTGACATGAATATATGAACACAACTATACTTT
TTGGTCTTTTGCTTTTAATTACTGTATCTGATTCCATGAG
GAATATCTGAATGACTGAAACCAATACACTTTGAGTCAGC
AGAGCTTCGGGAGATGCTGTCTCTGACGTCTTAAGAGCAC
AATGGTTTTTGCCCAGTGAAGGCAAGCCACACTACATTAT
CACATCAGCACAGCTGTGATGTATTTCCATAATCATCATA
TTCCAAAATTCTTGCAAGGCAGATAGTAAAATAATGTTTG
AGATCATTTTTATTGCTGCTCTTTTCGTTCATACTTGGCT
TAAATGTGTGACTGAGATGTCAAGTCGAATTTATATGTAT
GTATGTATGTACACGCACGATTGTTTAGTATATGTTGTAG
TGCTACAATTATATTAGAATATATTTGCCTTGTAACGCTT
ATGGTAAAACCCAATTTAAGCTGTTTTGTTGGCTTTTATG
AATGATATTTACTTTGCAAAAGGGTAACATTCAATCTACA
TCTGACCATAAATGCTAAAATGTTGTTCTGGACATTTTCC
ACATCTGCTGAAGACATCCCGTGGAAAAGCTGTGGAAATA
TTGAAGCACTTTGAAAAGCACTTATGAATCACTTCATCTC
TTTCTGTGTTAACAAGTGAAGTGAACTTGAAGGTCTATGT
GGTATTCCAAAGGAATGTTAGACAAACATGGACTCTCATA
ATCCATCAAGTACCTTGTAACGGAATAGCTATCGGACAAC
AGTCCACGTAAAGTATTTTTATGTGTCATAATGAGAAACA
TTTCACCAAAAGAAATGTGGTGTAAATCACAAAAAGAATT
TCTACAAGCTCTCTGGGATTTATCTGTAATAGTTAGCAGT
CTACTTGTCATGCTGTTTCCCAGAGGTTCTCCTCTATAGA
TGAACATGATGCATGTTATGTGAGTGTCGTCAAGGTGGAA
GTGGAGCCTTGTCAGTGAAGAATTCCAAACTCTTATAATG
TACATTTGCAGCTGTCACCGCAGGTTGAATTCTGTTTGTG
TCAGCTCTTTCCGAACGGTGCTCTGAGCTGCTCCTGGATC
TCTATAGATGGTTGTCCGTACTGGATGCTTTGTGCTGTTG
ATGCAGTTTCTGAAAAAAAGACAACATGTATGACAACAAT
AAACAAGCTGCTGTAAATTAAGATGTCATTTGTAATGAAC
TGAAAATATTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations