Transcript

cdc42-202

ID
ZDB-TSCRIPT-131113-3446
Name
cdc42-202
Previous Names
  • cdc42-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050552 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050552|OTTDARG00000035516|ZDB-GENE-030131-8783 cdc42|OTTDARP00000039689 cdc42-001 LG_ CU210919.20 Danio rerio protein_coding KNOWN, 2001 bp
GCGCGGCTCGCCCCTGCTCTTCAGTTCTGGAAACCCCAAG
CGCGCGGACCTGCCAACGCCCGGCGCAGAGAAACAAACAG
AAAGGATACGATCTTGAATGAGAGCAGTGGATTTATAAAA
GCACAGCTATGCAGACGATCAAGTGCGTCGTTGTTGGTGA
TGGTGCAGTGGGTAAAACCTGTCTATTAATCTCCTATACA
ACTAATAAATTCCCCTCCGAATATGTACCAACGGTCTTTG
ATAACTATGCAGTTACGGTTATGATTGGTGGTGAGCCGTA
CACCCTGGGGCTGTTTGATACTGCAGGTCAGGAAGATTAC
GATAGATTACGACCCCTGAGTTACCCTCAGACAGATGTCT
TCTTAGTCTGTTTCTCAGTTGTTTCACCTTCTTCATTTGA
AAACGTCAAAGAAAAGTGGGTACCCGAGATCACCCACCAC
TGTCCAAAGACCCCTTTCCTGCTGGTGGGGACGCAGATTG
ATCTGAGAGATGATCCTTCTACTATCGAAAAGCTTGCCAA
GAACAAACAGAAACCCATCACTCCAGAGACGGCAGAGAAG
CTGGCCCGCGATCTGAAGGCTGTCAAATACGTGGAATGCT
CCGCTCTGACGCAGAAAGGCCTAAAGAACGTATTTGATGA
GGCGATTTTGGCAGCCCTGGAGCCCCCAGAGCCCAAGAAG
AAGCGTAAATGTGTGCTGCTATGAGCGTCCACTTTCCCAT
CTCTCCCCCACTTCCCTCCTTCTTTGCTCTGCTAAGGCTG
GTCCACAGCTTTACACTCTCTAAAAAAAGCAATGTGTTAA
AGAAGTGAGTTTTCAATATTTGCTCTGCAATAAAGATATA
AAGACTACCCACCATACACATATATATACACACACAAACA
CACAACCCACATGCCCATTAATATTAAAACCTAGAGGGCC
TTTTCTAGTTTTGATTCCAGGGGCTTTACTTCTGTACTTC
ATGGTGACGTTTATTAGAGATGCTGCCTTGGTTTGCAAGC
TGAGTTTTGAACGTTTAAGTGGGTTAAAGATACACACAGT
TGTAATGGTTTGCAGGCGCACTCGGTCTCTAAAGTAGATT
TCAGGTTGTATCAGTTTCCATTGTGTGCCGTTCAAAATGG
CACTTCGAAATGACACTTCACTAGCCTAAGAAATAAAAGC
ATAGAATTAATATATTTCCAGAAGTGTTTGCAAGTATGCT
GTAATCTCTCTCTTTCTCTCTCTCTCTCTCTCTCCCTTTC
ACCGTTGAACATCATCACCTGAAGTGCTTAGAAATAGCTC
CTTTTATTCTTTGCCAATTGTCCCATTTGATAGGCATTCA
AGACAGTAGCCCTGTAAATGGTTGCAGTTGTTTTCCGTGC
ATAATTTTGGACTCCTCATATGAAAAATTTGGTCTCTCAA
GCAGGGAACTTTCTAACAGTGTTAGCAGAACAAGTGGCGT
GTTCTAATGCGTCGCTCGGGACCATGGAAGCGTTTGTTTT
TTCCAGAACTTGTGATGCATGTAGGTAAGCCTCCAGGTTC
CTTTGAATAGGTTATCATTAATGAATAATAATGTAAGCTG
ACAGACGTTGTTGTAGGCTCCAGTTGTTTTTATTTTACCA
AATGTTTTCTGTTGTTTCTTTGTGATTTATTTTTGGTTTT
TATCTAATTTTTTGTTTTGTTTGAATGTTTATTTCACTGC
TTTTGTTTTGGGGCTGGATTCCAGCACATCTCTGATCCAT
CTGTGTGTATGTTGTTGTTGTTGTTGTTGTTTTTTTTTTT
TTTGTAAAAAAGTTGTAGTCAAGATAACCTTGCTCTTACA
GACTTTAAACCCTGAACAGAACCAAGTTTCATACTGTAAC
ACAGGTGGATCAAAGTTGGTTTGATTTCCAGTCTTTCCCC
CCTCCCTAGTTATTTGTTTTTTTTGTTTTGGTGAAACACC
AAATGCTCTGTATGAAGTCTTTCCTTTGTACTGTATATGC
ATTATTTTGAGAAAAAATATTAAACTTATACCTTAATTGC
C

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations