ZFIN ID: ZDB-TSCRIPT-131113-3440
Transcript Name: si:ch73-106k19.2-201
Previous Names: ch73-106k19.2-001, si:ch73-106k19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050506 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050506|OTTDARG00000035486|ZDB-GENE-131121-349 si:ch73-106k19.2|OTTDARP00000048636 CH73-106K19.2-001 LG_none FO704603.1,CU459094.5 Danio rerio protein_coding PUTATIVE, 1970 bp
GTGACTGTTTGAGCTGTACGTTACAGAATGATCATCCTGA
CGTCTGAAGAACTCAAACAAGCTGAAAGTGTTTTGAAGAA
CTTTTTTCCAGAGTCCATTAAGGTTTATGGCTGTATATTC
AACATTAACAGAGGAAAACCTCACAATCTGGAGGTTATTG
CAGATCTGTGGCCAGATTTCACAGTCATTATTTGCAAACC
GAAGGTTCAGGGTGTAAAGAATCGAGAGGGAGATTTCAAC
ATATACAGCATCTACTCAAAGAGCAAAGACAGTTTAAAAA
GCTTTCTGGACACACCTGGTGTGATCAATAAAGACGCCTT
CACGTTACTGGCAGGTGTTGACATCAGGCATTTAGGAGCG
GTTCAGGAGTTTGCGGATCAGCATGGCATTCCCTCAAAAG
TCCAAGGAATGATGAACGTCTTGGTGCTGCAGGATCAACA
ACAGCTGCAGTTTAAAGACAGACACGCTGGCCTCAGTTTT
GCTCCTCTCAGCACGGCTCATGCACATCTGGTGAACAGCA
CATGGAAGTACGGCGGAGACAGCAGCAGCTACAACTCGGT
GCTGAACTACATTTCCCATAATCCTTCACTGTGTGTGATC
GAGGAGGGCCGGACGGAGCCCGTCTCCTGGCTGCTCGTGT
ATCCTCATGCTGCTCTCGGTTTGCTCTACACATTACCACA
ACACCGATGTAAAGGCTACGCCAGGCTGCTGGTGTCCATC
ATGTCCAAGAACCTCCTGGAACAAGGACACCCGGTCTACT
GTTTTGTGGAAGAAGAAAACAAGCCTTCCTACAAGCTTTT
CACATCTCTAGGGTTCCAGAATTCACCAGATTACAGAGCT
GTGTGGTTCGAGCTCAATAAACAACAGGTCAGCGATGAAT
AATGCAGGAAATAAATATATTAGTTACTTTAAAGGGGACC
TATCATGCAAAAATCACTTATAAACACTTTTAAATTGTAT
GAATATACAATTATATCATTTGTATTATAATTATATTGTA
TAAATATATCGGTTTCTACTAGTAAAAATTTATTAATTGT
ATGTTTTATAATCAGACTTGATGTAAACAGTCTGCAGAAA
CACTTTGATTGACATTCTCCCTTTGTATGTGTCATCATAA
GGGGAAAGCCCCGCCCACTAGAGGCCATCTCTCCCTCTTA
AGCATAGGATGATAGTCTTGTTTTTTAATCTGCCACTATA
CTGACACATAGGTGTTTATAGCTCCGCCCTCATCTGGAAA
GATCACAATCTCATTTGAATTTAAAGTGACAGCCTAAAAG
AGTCAGTTTCAGAGAGGTAAGGCTGACTTATACTTCTGCG
TTGAGTGACCCACGGCATGTTCTTTGCTTATAGCCATGCA
TTTACACTTCTGTGTGCTGTTTGTGTTGCTCTGCAATAAC
ACTTCTGAAATGTTAGCTGGCAGTGAGGTTATGCTCCTCT
GTGTCGAGTCTATATAAAATACTAAGATTTTTAGAAATCA
CCAAGCGACTCCCCCCCACATCCCACCCCAAATATCTCAC
GACCACCCAGGGGTCCTGACCCCTACTTTGAGAACCACTG
ATCTAGTGGGTTGTCTACTGTAATCTTTACGGTGCACGTT
CGTGATTTCAGAAGGTGTAGCTTTTGAGTAGCAAGAAAGG
GACTGTGTTTGATATTATGCTATTATGCATTTTGGCAGTT
TACCTACTGCATTTTTAACAAGACCTTTGGAGATTTTAAC
AAATATTTGTAATTTAACGTAATTAGCATATTTCTAGTTT
AACCAGCTAAACTCTGCTGCTATTTTGGGATTTCCACCTG
GATTTTGCCTACCCAAATTTAAAAGCTTCCCAAATCCACA
TGCAGAGGTGTAAATGCAAAAATTTGGTTTTATTTGAAAG
AAAACCCTTTGAATTTTCATAAAACACCATTGAAAGTGTT
TAAAATATCTGTATATGTCGTCTGTGTTATAATAAACACC
TAAAAAAAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-106k19.2-201 Contained in:
[BAC] CH73-106K19 (1)

Genome Resources: Vega_Trans:OTTDART00000050506 (1),  Ensembl_Trans:ENSDART00000169776 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134835 (1) 1958 nt
GenBank:BC124822 (1) 1943 nt
GenBank:EE692655 (1) 862 nt
GenBank:EH446252 (1) 802 nt
CITATIONS (2)