Transcript

si:ch73-106k19.2-201

ID
ZDB-TSCRIPT-131113-3440
Name
si:ch73-106k19.2-201
Previous Names
  • ch73-106k19.2-001
  • si:ch73-106k19.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050506 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050506|OTTDARG00000035486|ZDB-GENE-131121-349 si:ch73-106k19.2|OTTDARP00000048636 CH73-106K19.2-001 LG_none FO704603.1,CU459094.5 Danio rerio protein_coding PUTATIVE, 1970 bp
GTGACTGTTTGAGCTGTACGTTACAGAATGATCATCCTGA
CGTCTGAAGAACTCAAACAAGCTGAAAGTGTTTTGAAGAA
CTTTTTTCCAGAGTCCATTAAGGTTTATGGCTGTATATTC
AACATTAACAGAGGAAAACCTCACAATCTGGAGGTTATTG
CAGATCTGTGGCCAGATTTCACAGTCATTATTTGCAAACC
GAAGGTTCAGGGTGTAAAGAATCGAGAGGGAGATTTCAAC
ATATACAGCATCTACTCAAAGAGCAAAGACAGTTTAAAAA
GCTTTCTGGACACACCTGGTGTGATCAATAAAGACGCCTT
CACGTTACTGGCAGGTGTTGACATCAGGCATTTAGGAGCG
GTTCAGGAGTTTGCGGATCAGCATGGCATTCCCTCAAAAG
TCCAAGGAATGATGAACGTCTTGGTGCTGCAGGATCAACA
ACAGCTGCAGTTTAAAGACAGACACGCTGGCCTCAGTTTT
GCTCCTCTCAGCACGGCTCATGCACATCTGGTGAACAGCA
CATGGAAGTACGGCGGAGACAGCAGCAGCTACAACTCGGT
GCTGAACTACATTTCCCATAATCCTTCACTGTGTGTGATC
GAGGAGGGCCGGACGGAGCCCGTCTCCTGGCTGCTCGTGT
ATCCTCATGCTGCTCTCGGTTTGCTCTACACATTACCACA
ACACCGATGTAAAGGCTACGCCAGGCTGCTGGTGTCCATC
ATGTCCAAGAACCTCCTGGAACAAGGACACCCGGTCTACT
GTTTTGTGGAAGAAGAAAACAAGCCTTCCTACAAGCTTTT
CACATCTCTAGGGTTCCAGAATTCACCAGATTACAGAGCT
GTGTGGTTCGAGCTCAATAAACAACAGGTCAGCGATGAAT
AATGCAGGAAATAAATATATTAGTTACTTTAAAGGGGACC
TATCATGCAAAAATCACTTATAAACACTTTTAAATTGTAT
GAATATACAATTATATCATTTGTATTATAATTATATTGTA
TAAATATATCGGTTTCTACTAGTAAAAATTTATTAATTGT
ATGTTTTATAATCAGACTTGATGTAAACAGTCTGCAGAAA
CACTTTGATTGACATTCTCCCTTTGTATGTGTCATCATAA
GGGGAAAGCCCCGCCCACTAGAGGCCATCTCTCCCTCTTA
AGCATAGGATGATAGTCTTGTTTTTTAATCTGCCACTATA
CTGACACATAGGTGTTTATAGCTCCGCCCTCATCTGGAAA
GATCACAATCTCATTTGAATTTAAAGTGACAGCCTAAAAG
AGTCAGTTTCAGAGAGGTAAGGCTGACTTATACTTCTGCG
TTGAGTGACCCACGGCATGTTCTTTGCTTATAGCCATGCA
TTTACACTTCTGTGTGCTGTTTGTGTTGCTCTGCAATAAC
ACTTCTGAAATGTTAGCTGGCAGTGAGGTTATGCTCCTCT
GTGTCGAGTCTATATAAAATACTAAGATTTTTAGAAATCA
CCAAGCGACTCCCCCCCACATCCCACCCCAAATATCTCAC
GACCACCCAGGGGTCCTGACCCCTACTTTGAGAACCACTG
ATCTAGTGGGTTGTCTACTGTAATCTTTACGGTGCACGTT
CGTGATTTCAGAAGGTGTAGCTTTTGAGTAGCAAGAAAGG
GACTGTGTTTGATATTATGCTATTATGCATTTTGGCAGTT
TACCTACTGCATTTTTAACAAGACCTTTGGAGATTTTAAC
AAATATTTGTAATTTAACGTAATTAGCATATTTCTAGTTT
AACCAGCTAAACTCTGCTGCTATTTTGGGATTTCCACCTG
GATTTTGCCTACCCAAATTTAAAAGCTTCCCAAATCCACA
TGCAGAGGTGTAAATGCAAAAATTTGGTTTTATTTGAAAG
AAAACCCTTTGAATTTTCATAAAACACCATTGAAAGTGTT
TAAAATATCTGTATATGTCGTCTGTGTTATAATAAACACC
TAAAAAAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations