Transcript

srsf2b-201

ID
ZDB-TSCRIPT-131113-3410
Name
srsf2b-201
Previous Names
  • srsf2b-001
  • ch73-366l1.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050030 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050030|OTTDARG00000035193|ZDB-GENE-030131-2420 srsf2b|OTTDARP00000039268 CH73-366L1.3-001 LG_ CU463857.9 Danio rerio protein_coding KNOWN, 3520 bp
ATTGTTGTACTGGCGGGCAGGTCGACGGCAACTAGTGTTT
GTTTATTGCTGGAATACGCGGTCAGACTTAGTTGTTGAAG
ACAAAAGCGAATCAAATTCTCTTGTTTTGTTTGGTACGTT
TATTCAAAATGAGCTACGGCAGGCCTCCGCCGGACGTCGA
CGGAATGACTTCGTTAAAAGTGGATAATTTAACGTACCGC
ACGTCGCCGGAGACGCTGAGGCGCGTCTTTGAAAAGTACG
GCCGAGTTGGAGACGTTTATATTCCGCGAGATCGATACAC
AAAAGAGAGCCGAGGATTCGCTTTTGTGCGCTTTCACGAT
AAGAGGGACGCCGAAGACGCAATGGACGCGATGGATGGAG
CGATACTGGACGGCAGGGAGCTCAGGGTTCAGATGGCCCG
GTACGGCAGGCCGCCAGACTCCTACTACGGCGGCGGCGGC
GGCGGACGGCGCGGCAGCGGTGGCGGGGGAGGCAGTAGAA
GACACGGTGCACGCCGCAGCCGGAGTCCGAGGCGCCGGAG
ACGCAGCCGTTCCAGAAGCAGGAGCCGGTCTCGTTCCCGC
TCTCGGTCCCGCTACAGCAGATCACGCTCGCGCTCCTATT
CCCGATCCCGCTCCAAATCCCACACTCCCAACAAGAGGAA
GTCCAAATCTCCCTCCAGGTCCAGGTCACGCTCAAGATCC
AAATCCAGGTCCCGTTCCCGGAGCCGAACGCCGGCGTCCA
ACAGAGAGTCGCGGTCCAGGTCTAAAAGCGCACCGAAGTC
TGCTGGAGATGACGGACAGGCATCATCGTAACTCTGCTCA
GGGTGCATCTCTTCGCTTACCGTGGGCTGATTATAAGCGT
CTGGTGTCGGACGGAGCCTGAGGATCCGCAGACTGGACAC
CCAGAAAATCCACACCATGGGCCTAAAGGTCATTATGACT
GATCGCCATGAGTGAACTGTTCAGTAGTTGCAAATCTGTT
CCTTCCATACATTGTTCCCGTTTTTGCAGTGAGGTTGTTT
TCAAATGTGTATGTGCTTCTGAATTCGTCGAGTAGGACGA
GCATCATTTCTATTGGCCTTTAAGGTAAACGCATCTCGGT
GATGGTTTCTAGCGGCACCTCACCTTTCTGTTAGAAGCAT
ATTTAGATCTGACTTTTGTTAAAAGAAAACTTTTTTGGAA
ATGGGCTCATTTTACAGCTCCTCTCGAGTTAAAAATGTGA
GTTATATAATTTTTCAATGCATTCAGATAATTTTCGGGTC
TGCAGGGGAACGTTTAGCTTAGCTTAGCATAAATCATTGA
ATCGAATTAGACCATTAGCATCTCATTCAAAAAAGAAAAA
CTATTTTTGATTTGATTTTTTTATCAAAAAAATTATTACT
AAGTACTAAGACCAACACAAAATGAAAACTTGCTATTTTC
TTGGCTAATATAACTAGCTATACTCTCATTCTGGCATAAT
ATTAATCTCCAGAATTACTAGCACTGTGTAATGTGATTTT
TATATCATTTATGCCTGTGGGGATGTAACTAAAGATGCTT
TAAACAGGAAAACAATCATTGTTGAGCGAGATGCTAATGG
TCTAATTTGATTCAATGATTTATGCTAAGCTATCTAATAG
TGCTCCTGCAGACCAGCTCTTATAGAGTTAAACAGGTGAG
TTTTAACTATTTTCAGTGCATTTAGCCAATCTCCTGGTCT
GGCGGGAGCACTTTTAGCTTAGCTTAAAACATTTAGCTTA
GCTTAAACATTTAATCAGATTAGACGATTAGCATCTTGCT
CAAAATGTAAAAAAAAAAAGTTGCTATTTTTAGGTTGATA
TGGCTAGCAACTATAATTTATATACCATTTATGCCTGTTG
CGACCTAACTATAGAAGAGTCAAGCTTTAAATAAGAAAAC
AATAATTTTTGAGCAAGATGCTAATGGTCTAATCCGATTC
AATGATTTATGCTAAGCTAAGCTGTTAGTGCTCCTGCAGA
CCAGCTCTTCTAGCGTTAAATAGGTGAGTTTTACCTATTT
TTAGAGCATTCAGCCAATCTCCAAGTCTGGCACGAGCATT
TTTAGCTTAGCTTGGCATAAATTATTGAATCAGATTAGAC
CAATAGCATCTTGCTCTAAATAGCAAAAAAAGTTGCTATT
TTTAGGCTAAAGTGGCTAGCAACTATACTCTATAACCTAG
CTAGCAACTATACAACAAATTTATATATCATTTATGCCTG
TAGCGATGTAACTATAGTAGAGTCGAGCTCTAGAGAGGAA
AACAGTTTTTGAGCAAGATGCTAATGGTCTAATGCGATTC
AATTATTTATGCTAAGCTAAGCTAATAGTGCTCTTGCAGA
CTAGCTATTGTAGAGTTAAATAGGTGAGTTTTACTTATTT
TCAGTGCATTCAGACAATCCCCTTTTCTGGCAGGAGCACT
TTTAGCTTAGCTTAGCATAAAACATTGAATTGGATTAGAC
CATTAGCATCTTGCTCGAAATAAAAAAAAATGTTGCTATT
TTTAGGCTGATATGGCTAGCAACTATACAACTATAATTTA
TATAGCATTTATGCCTGTGGCGATGTAACTATAGTAGAGT
TGAGCTTTAAATAGGAAAACAATCATTTTTGAGCAAGATG
CTAATGGTCTAATAAGATTTAATGATTTATGCTAAGCTAA
CAGTGCTCCTGCAGACCGCCTCTTCTAGAGTTAAACAGGT
GAGTTTTACCTATTTTCAGGGAATTAGCCCATCTCTGGGT
CTGGTGGGAGCACTTTTAGCTAAGCTTAGCATAAAACACG
GAATCAGATTAGACCATTAGCATCTTGCTCGAAATTAAAA
AAAAAAAAAAAAAAGCTTTTTTTAGGCTGATGTAGCTAGT
AACCATATATATTTTTTAGCATTTATCCTTGTGGCGATGT
ATCTACAAAAGAGTCAAGCTTTAAATAGGAAAACAATAAT
AATTTGAGCGAGATGCTAATGGTCTAATCCAATTCAATGA
ATTATGCTAAGCTAAAAGTGTAGACTGAGATCGCCTGAAT
GGATTTTAAAATGGTAAAAATCTCTCTAGGCGAGCAGTAA
AATGTGCCTATTTCCAAAAAACCGTGGAGTGTTTCTTTAT
AACCTGCTTTAGTGATTCCTTTGCTTTATTCTGAAGCCTG
AAGAGTGTCAGTAGCTTGTGTTTGTGCTGCTGTATATTAC
AGTTTTGTTGTAAAAGCAGCGTTTGTTTTTCTTTTAGACA
TCTTGCTGTGTGTGTGTGTGATGCTGGATTCTAACCCTGT
GTCTTGTGTATTTTTTGTGCACTAGGCGCAGTTGTCTAGC
TGTTGAGTTTTGCTGGTTAGCTGTGTTGCAGTGCTGTGTC
CGCCGGTTTTCTCCAGTTTGCTGCTGTTGCCGAGGTCAAA
CAGTAGCAGCACATACTGTGTTGGTGGCAGAAAAACGCTT
TCACTTTCCTTTTGTGTTCCTCCGTTTTGGAAAGCATCTT
TATCGATCAACTTCTGTTCTGTCCTTTTGATTATTTATTT
ACATTTTTTGGGGGATCTTCAATAAACCAGTTGTTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations