ZFIN ID: ZDB-TSCRIPT-131113-3404
Transcript Name: zgc:174268-201
Previous Names: ch211-110e21.4-001, si:ch211-110e21.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049991 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049991|OTTDARG00000035168|ZDB-GENE-131126-43 si:ch211-110e21.4|OTTDARP00000039235 CH211-110E21.4-001 LG_ CR352225.13 Danio rerio protein_coding KNOWN, 815 bp
TGGATGGAGTATGAGTCGGATCGCTGATGAATGCTAAACT
TTGCCGTTTGCTGTATAATTATTCTTCTGTTACGGGTGTT
GTGCGTCTTTTCAAAAAGAACGAGATTGCGTGACGATGAT
AAACTACTAAAAGCTGGAAATACTTGAGTACATCATTCTT
TAATGAAAAGAAGAGGCAAGATTTTTTCACCTAACTCCGT
GTGGAAAGAGATTGATTTGGATGCAAAGCAGCCATAAGAT
TCACAAGATGGTCCGCACTGGAGAGAAACTATTCACATGC
ACCCAGTGTGGTAAGAGTTTCACACGATCATCACACCTTA
ATCAACACATGATGACCCACACAGGAGAGAGACCATTCAC
ATGTACCCAGTGTGGTAAGAGATTCACACAATCATCTTCC
CTTAATCAACATATAAAGATCCACACTGGAGAGAAACCAT
TCAAATGTACCCAGTGTGGAAAGAGTTTTACAATCTCCTC
ATTGCTTAATAGACACATGTTGACCCACACTGGAGAGAGA
AAACACAGATGTGATCAATGCGGTAAAACATTCACGACTG
GTTCATTTCTGAAGCTCCATCTAAGAGTTCATACAACGGA
GAAACCGTATTCGTGTTCTGTGTGTGGAAAGGGTTTTACA
TGGCGGACAAATTTAAATCGACATCAGAAGATCCACACTG
GTGTGAAAGAGCATTACTGCTTTGAGTGTTGGAAGACTTT
TATGACAGCTGACGATTTGGAACGGCACCAAAGGACTCAC
ACTGGAGAGAAACCGTACACGTGTTCACACTGCGACAAGA
GATTCAGTCAGTTAG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174268-201 Contained in:
[BAC] CH211-110E21 (1)

Genome Resources: Vega_Trans:OTTDART00000049991 (1),  Ensembl_Trans:ENSDART00000153642 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC092002 (1) 2000 nt
GenBank:CV107650 (1) 828 nt
GenBank:DY572674 (1) 736 nt
CITATIONS (2)