Transcript

wu:fe05a04-201

ID
ZDB-TSCRIPT-131113-3325
Name
wu:fe05a04-201
Previous Names
  • dkey-29h14.7-001
  • znf576.2-001
  • zgc:175096-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048596 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048596|OTTDARG00000034361|ZDB-GENE-030131-1738 znf576.2|OTTDARP00000038127 DKEY-29H14.7-001 LG_ BX571853.4 Danio rerio protein_coding KNOWN, 3216 bp
AGCTCACCTTCTGCATGCAACCTGATTTGTGCTTTATTAC
TTTGTGTCGTTATAAAATAGTTTTTGCCGTTGACGGTAAT
TTCAGTTACGCTTTGAGCAGTTGGTGATATTTTCAAAGCC
GATCATGGCAGTTAAGGAATGACTATAAGTTAGCAGGCAG
TATCAAAGGTCCATTGTTGCATTGCTGAACAGCAGTGTTT
GCAAATGCTCGTCGAAGACAACTAGGGCACCATGTCAGAG
TTTACCCTCGATATCCAGCTGACAGAGTTGGGTTTTTCAA
ACTGGAATTTTCCCCTCTGTGAGCCACCAAGTGTTAAGGA
GACATTTTTGCCAGCTCAGAGCACCACAGAAAAACCAACA
ACTGCAGACTGTCATGAAGATCCCTGCTTCGTTCCAAATG
CCTTGACAGAAAAAAGCTTTCTACAGGACCATCAATATTT
CTGTCCCTTCAAACCAAACTCTCCCATCAGCGTAGAAACA
GCTCAGAGTGATTCAAATATCGTTAGCACCGAAAAGAAGA
ACAAAGCTATTTGCAACTCATGGAATAAAGCAAGAAAAAG
AGAGCGTGCAGGTCGAAGAAACAGTGATGACTCTCAAGAT
GGAGAAGAGGAAATGGAAAAAGATGAAGAGGAGCAGACAT
GTGCAGAGGGGACGCTAGAAACCTCCAGTCCTACCATGGA
GGAAGTTGTGTCTGGTGAGGAAGGGACAGATGAAAATGAA
GTGGAATATGTTTTGACTGATGATGATGGGGATTATGTTG
ATGAAGATGAAGAGGTGGAAGATGATATTGAGGAGGAGGA
GGAGGAGAAGGAGGAACAAGATGAGGATGTTTCCTGGTCA
GAGTCGAACGAAAATGGAGAAAACAAAGACAATCTCTGCC
ATGTGTGTGATCTCACCTTCTCCTCTCTCTTCTTGCTCCG
AGAACATTTGAACATGCATACGGGTGTTCGGCCCTACCGC
TGCGACGAATGCAGCAAGCAGTTCTGCCAGTTAGTCAATT
ACCGCACACACCTTCGCTCCCACTCGCAAAAGGCCTCCAT
CCACTGCCGCGTTTGCTCAAATACCTTCGAGACCGAGGAG
CAGCTTCAACACCACTTGGACACTAACCACTTTGAGAAAG
AGTTCTACCAGTGTGATTTTTGCAAGCAGATTTTCACTGA
CCTTGAATTGTGCAAGGATCATGTAGAGGCGCATAGGCAA
CAGGCCAAGCGGCATTTGTGTCTCAAATGTGGCTCCAGTT
TTCGCCATCGCAACTCTCTCCTACTTCACCTTGAGTGGCA
CAGCAGAGGCTTTTTCTCCTGCCCGGACTGTGAGCGAACG
TTCTCCAGCAAGACTTCTTTATTACGCCACAGTTTCTCTC
ATTTGGGCGTCTTGCCGTACACGTGCCTGAAGTGCAAACG
TCATTTCCGTTTGCCCTCGCTCTACCACAGCCATGAGTGT
AAGCCCGAGAGCATCCAGTGTATGGCGTGTTTGGTTTTCT
TTCAGAGTCAGGAGGATTTTGACAAGCATAAGAAGGAAAC
TGGATGCTGGGGTCATCAAGGGTCTTTGCAGACCAAGACT
GATGAAATCCGTTGCATGGAGTGTGGAAAAGTGTTTGCGA
GCGTCGAGGAGCTGAAGAAGCACGGGAGCACACACCAGCG
GGTCCTGAAATGTGCCGAATGCGGGATGGGTTTCCGTTCT
GCGCTCATGCTTATGTCACATATGGGAGGTCATGCGGCAC
AGCGGCCGTGCCTCTGCCAGGACTGTGGCCTGGGCTTTCC
CCATCAGCAGGGTTTTGACAGCCACCTGAAAACTTGTGGA
TTGGAGGCACCACCGGTGGTTACTGTGAAGAAGCCAAAAC
TGAAAGCAAGCCCCACAACAAAACCAGTTGCTCAAAGCAT
AATCTTTCAAACTATCGCTCAGCCCTCAAATCCTGCAATG
TTCTCTAGTGGCTTGAAGAATGTGCAGATACTTCCAGTAG
GTGATCAGAACAGGACTGCTGATGGCAAATGGAGTCTGAC
CTTAAATGAAAAGCCTTCTCCAGGAACGCCTTTAGTGATG
CTTCTGCCGGTCCCCACCTCAGATTCTACCAAGAGCTCAC
AAACATTCCTACCTTCATCATTAATCTTAGAAACCCCTTC
AACCACTTCAAATATCATTCCCCTTCCGATGGCCCCATTC
AGCAGCGTCATTACTAAAGAAGAGCCCAACATTCCTTCAA
ACACACTCATTCCTGTGGAAAGCCTCGACAGTACCTCAAA
GAAGAGATGGACCATTGTTGAAGGTCAAGGTTCTGTTCAT
GGTTTTGATATGGAAAACTCAAAGGCAGGTGAACAGACTA
CAGTTGTGATTCAGGATGAAAGAATGATTGTTGCTACACA
AGTAATGGAGAATGAGCAAAAAATTCAATCAAACATGAAA
TCTAATGTATCAAGGGATGAAAAAACAAATCCAGGAGGTT
TGTCAGATGCTGCTGAACCTGCAAACGCAGTGACCCCATT
GTGTCAAGGGCAAACACTGGATTCTTTACAAACAGACTCT
CTCGTTTCTGCTTCGTCAGAAATGACTCCTCACAAAAGTA
AAGACGAGCAGTGTTTAGAAGAAGACAAGTCATCTAACAG
GACATGCACAGAGACAGAATTTACCTTGATGGAGGACAAG
GCAGAAGATGGTCCACAGGGTCAAAACGAGTCTGGCTTTG
ACGTGGAGGTGGAGATTCGGGAAGATGTGGATTCCAGTAA
TACGGAAGTGGAGATCGGCGATGAAGACAGCGGAGTGGAC
ATGTTGGACGGTGAGCTTCATGAATGTGTGACTTGTGGAC
AAGTTCTTCCAGAGAAGGACATGGTCCAGCACTACATGAA
GCATGCTGCGGTCAATGACGGTCCTGAGCCCTCGCCTGTT
AACAGTAGCACACACACTACACAACGCAGCCCTCCACACA
GCCCGCTTAGAAAAAGACTGCGGTCTGGCACAGTGCTGTG
ACGTTAGTTCACAAATGTTTAGATGATTTTTTTTATTATT
ATATTAAATTGATTTGACTTGATAAATATTACACCATCTT
TACATGATTTATTTTCTTTGGGAAACGGGTGTCACAATTA
TTTTTCCCGGATGGTGAAAAGTTTGGTGAATGTTAAAACC
AAGTCTCTTTTGAATGTATTCTGGTTTGCTTTCACAGTAT
TTCATTGCATTTCCACTATGATGTGCAGGATACAATAAAT
CTAGATTAGGAAGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations