Transcript

si:dkeyp-84f3.5-201

ID
ZDB-TSCRIPT-131113-3322
Name
si:dkeyp-84f3.5-201
Previous Names
  • dkeyp-84f3.5-001
  • si:dkeyp-84f3.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048587 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048587|OTTDARG00000034353|ZDB-GENE-050208-162 si:dkeyp-84f3.5|OTTDARP00000038113 DKEYP-84F3.5-001 LG_ BX539313.4 Danio rerio protein_coding NOVEL, 4037 bp
AATCGCACACGAAGAAGAGTGCGAAGAGGAAGCTTTCGTT
TTTTCGTCCCCTCTTGTGTTGTCTGTGTTTCTCGAGGATT
TAACGCTTTAGGATATACGGTCGAATAGTTCAGTTGACCG
ATCAAAGCCAAAACCAACGCACAGTAAACACTTAGTTTGC
AGAGGGTCGCACTATTGCTACACGCTAGACAGAAAGAAGA
CGGAAAGCTAGACGGAAACTTGCGGCCAGCGTCCGAACCT
CTTCAGAAGTGACATCGAGAAATACTGGATATTGTCTTCA
GTTTGCTCTGCATTTACTCAACGGGGAGTAAATGCTTTTA
AAGTACCAGGATTTTATGGCAATATCTGAATTGTGAGCCA
GCATCTGAATGAAGGCAGGCCATATACCTGACGAGGTTTA
CATCACTGTTTTATGGTCAAATGACAGATTTTTTAAAACA
GTTGATAATGATTGATTTGACAATCAAAGACTTTTTAAAT
GATACCCTTTAATCCTATATGTAATTTTCTTTTTTTTTAT
TTTTATTGATGTTAGAGTAGTAATTTAAGTGCTGCTTTGA
CTAGTTGGGTTTTATTAGATGTGTAGGGGAATCTAGCTTT
GTTTAATAACTGAGGTGAGACTGGAACAGATTACATTTAT
TGGACAATAATTGCAATATTAAAAGTTATCATGCATATAT
AGAAGTTTCTGAATATTTGCATAATTATGCTCCCAACTTC
CTAAACTATTGACATTTATCATTCCTAAAAAGCTGTATTT
GGTTTTGTCAAGATGGCATTCTCAATGAACTTTACTCAAG
AGTTAAGAGGAGGAGATGCCTTCATCTGTACAGAGTGTGG
TGAAGGATTTAGACTGTATCCAAAACTTGTTGAACACATG
GCCATACATGGACTTACTGGCGTATTTTCCTCTGATGGTA
TTAGTAATGGTAGTTCTGTCAACCCATCCATTGAGGTTGC
GCTCCATGAAAATGGAACACTTACTGTGGTTGATCGATCC
GTCTTGTCTAACTTTACCTTCTTGTTTGGAAAACCTCAAC
CAAAGAGATTCTGCCCACCCCCCAGTCAAGAAACCATTGT
TCCATCTAAGATGCCAGAAAAAGAGCCTGCTCTGTATAAA
TGTGATAGATGTGGACAACTGTTCAAAACCTCCAAAAGCT
TACATCTGCATCAGCAGTATCGTGCTCTTGAACAGGGGTT
CAAATGCACTCTGTGCTGCAAGGTGTTAAATGATCGAGAG
AGCCTGCAGAACCACCTTCAAAACCATGCTCATGAACGCT
TTTATAGTTGTGGGCACTGTGGAAAGCGATTCTTAAGACA
AGATTCCTTGCTGTCCCATCAAAAACAGTGGCATGGATCT
GCTTCTTCCAGGATTTTGAGTAGATCACAGGAAGATCAAG
AAAACAGCATGGATAGGTCATATCCTTGCAAATCTTGTGG
CTTGCGCTTCTTTTGGTTGTCTGACTTACAAAGCCACCTC
AACAGTCATTCTCGTGTCAATAAGTCGCCCAATGAGGTTA
TGCAAGATCAAGCACTTGGAGAAGAAAACAGGAAAATTGA
TGATAATTCAGTTATCTCTCAATTCAATGAACCATGTTGT
GGACTGTGTGGCCAAAATTTTCTCAACACTTCAGATTTAA
GAGAGCATCATAAAGTCGAACATCCAGATGAGATTGAAGT
AAAGGATTCTTCAGTTTTACCAGCTAAGGCAAAACAACAA
TACCATGGTGTAATGCGACACATGGTTGCAAAGCAGCACA
AGCAGTTGCTAAGGGTGAACATAAAAGGAAAACCTAAGAG
AATCAACAGGGCCACCTATACTGGTAAATTATTCTCCTGC
AAGCACTGCCATCGTGTCTTTGTACACTCAAGCAGTCTCT
CGCGTCATATGCGATACCATAAAGGTACTCTGCATGCCTG
TGTTTATTGTGGAAGGCACTTTCCACAAAGATGTGATGTC
ACAAGGCATGTGGCCATGTACCACGCTTCAGAGCTTCAAT
CCAAATCTCAGGAAGAGTCAACGATGGAACATGAGACTGG
AAATGGTGAACAGGAACCTATGAAAGAATCAACACAAACA
ACAAGCGATGGTGAACAGGAAGATCTTGAAGAAGAAAATC
AACCCTCATCCAAGTCAGAAGACCTGTTTGGTTCTCGATT
TAAGAAAACTTTCAAGCCAAAGATGAAGTATAAATGCAAA
GAATGTTGCAGAGTCTTTGGACTACTTAGTGTTTTTCAGC
GGCATATGGTTCACCACAAGAGAAACCCCTACAGATTATT
GCTAAGTTGCCCTCTCTGTCCAAGTCGCTTCTCATTCACC
TCTGCTTTAAATCGCCATCTTGAGTGTCATCATAAAAGAG
ACCCGGGGACGGATGTCACAAAACCTCCCGAAACTAATGA
CATTAATTCCCAAGTTCAACAAGAAGATTCTCCTACCGAA
TATCCGGATTCAAATGCAAATATTGACATGTCATCAGAAA
TACTGAATGAATCTTCTGAATGTTCTCAGATCTAGTGATA
CACAATATGGCCAACAGCATATGGACACTCTTTTGTAATT
AACAGATTTGGCTCATCCATAAATGTCAGTATAATGGTTA
TTCCATAAACCTTTTTTTTTGTTTGTTTGTTTTTGGGAGG
GTGGGCATATTTCTTATCCAGCCAGCCAATGTCCCTGTGC
TCAGAGCTATCGTCTACTTGTTCATGTGGTGAAAAATGCT
AGTGACGTGCAAATCCCTGACCTAACCCCTACTGGAACAT
CTTAGGGGGAGGTATTGAGATTGCAAACTACGAGCCACTA
AAGGGGTTACATAATATTATTTCCTGACCTACTTCATGCT
CGGCCTTTACAATAGTGTTCTTTCAAAGAGGGATGAAATC
TTTTACTGCAGCAAAAGGAAATACATTAATGCTTTTGTTC
TACTTGTGTCTTTTGTCTAAAATAAAATTTTGATTACATG
TGAGGTCGGGGACCGATGTTGGAAAATGTGTTGATGTTCT
GTACCCAAAGGCATTTAGGTCTTCATGCAAGCTGTCCTTC
TGGAAAATGGTTCTACTAATATAGTTGTACTAGAGTTGGA
ATACCTAGCCACACTGTAAACAAATTCTGTTATTTAACAG
TTTCCTTATTTTATGATTCACAAGTGTTTTCTGTTTAACT
GCTGTTGTGAATTGCATTATGGTACCTTGATCTCTTCTCT
GTTGACCTTTGATGTTGGAAATAAAACTCTAGGGTTTAAC
AAATTGACTTCTATTGGCATTTTAATAGTTTAAAATGATA
AAACGTATACAAAATAATGTAGAGAGAAATAAGTCAATAA
ATAAAAAAAAATGTATTGGCAGTTTATTACAAGTTTTTTG
TACAATAACATACAACACCAACCCAGACAATATATCACTT
TAAACTATTAAAAAATATAAACGTGAATCACAAAATATGA
AAAAGCTGCTAATTTACAGATATCTTTTTACTGTGCAGAC
CTATTACAAGAGAGTGTCCACACTAAAGATGTAGTTAATG
TCAGTAACATTAACAGTGCTCATAGATACTGAAACATTTT
ACATTTTCTATTCTTAAAATGTTGTACTTCTATATCATTG
GGCTTTTCAGAGGTTTCAAATGATTGTTTTTCTTGTGTGC
TGCATTTAATGTATATAAAATGTTCCCATCAAATAATCTT
GTGCGTTTTCAGATTTTTGGATATGCTGTTGCAGTTCTAA
ATTGTGTCATACACAAACTTAAGGGACCTGTAAAAGAATC
TTTATAATACCAGAGTATCTGAAATTTAATGCATATCAGA
AGCAATTCTGCAATTATTCATTAGTACATTTTAGTAATTT
GTATTTTAGATGTTTTTGTAACCAACAACCTAGATTTCAC
TAGTCTCCATACAGGTCAAACAGCGAAGCTTTTATTTATT
TATTTTTATTTTTTGTATCGCCATGTTACGAAACATACTA
TTACTATTCTCTGACATCAGTAGTTTTGTGCAAGTCTGGT
TTCACTTGTTTAAATAAAGAATTCTGTTTTTCTTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations