ZFIN ID: ZDB-TSCRIPT-131113-3321
Transcript Name: si:dkey-79d12.5-201
Previous Names: dkey-79d12.5-001, si:dkey-79d12.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048584 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048584|OTTDARG00000034350|ZDB-GENE-131127-429 si:dkey-79d12.5|OTTDARP00000038111 DKEY-79D12.5-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 3551 bp
CAACGTGTTAACTCAGGGTATCGTCCTGTTTGGACATAAC
AGTTTTGATCTGAGGAAGTACAGCTAAACACAAAGAAACA
CATCCAGCCGTTTGGGATTCAGCTTGTATTGTGCTGAGAA
TGAAGAGAGAAGTGAGAGCCGGGGTGAACTTTCTGAAAGG
TTTGGCAGTGCAGCGAGGAGGTGTAGATCAAATTAAAGCC
AAACTTTTTGCATCTAAATTGCAAGAGCTTCTGCTGGAAA
AGTTTACAGGTCACTGGTATCCAGATAATCCCAGCAAAGG
GCAGGCGTACAGATGCATCAGAATAAATGCTAGCCATCCC
TGTGATGAATCCGTATCAAAAGCCTGCATGGAGAGTGGCT
TCAAGTCAAGTGAGCTGGGCTTTCCTCGTGAAATCACAAT
GTGGATCGACCCCATGGAGGTCTGTGTCCGGTCTGGAGAG
AACGGCAGATATTTCACAGTGGCTCATTTTGATAAAGTGG
AGGATGAAGAAAAGGACTCGAATAATAATGACACTCTTAG
CCAAGTGGATTCTGTGAATCTGGATACATCAGACTATCAT
TCGGCAAGCTCATCTGACTGTGGCTCAGCGGTCTCAAGTG
ATACAGAAGAGGAGGTGAAAGACAATAAATTGAGAAAAGT
GCCAGAGAGGACAGCAGAGAGCACACTTTGTACATCAAGA
TCCAAAGCAAGGGAGCCAAAAGGAAGACGCAAGTTTCCTC
CATCTCAGATCCCTGGCCCGCAGTACTTCTATAACCCTGC
ACCGATGTGGCCCCAGTACAAGAAAAAGAGAGGCATGTTC
TTCACCACTGTCTGCGCACCAGCACCTTCTCCACTGTTTG
CATACTATGTTCTGCCCAAAGCAGCTCCTCAGTTCATTGT
GCCTCACGCTGCCCTGCAAACCTGGGGGACGGTGAAAGGG
TAAAAAGCTCCAAAGCAATTAGCACATACACCTAGTACGT
GGGCGTTTCTGAATAATATGAAACTTATCTGCCACTGCAG
GGAACTTTATAGCTTATCATAATGAACTTGAGATATAGTG
TCAAGCCAACTATTTAACTTTTGTATTTATTTTTTGATAC
GCCTTTTGCTTTTAACATATTTTATCATTATATAGGCTTT
CTTTAGTTGAGCGATGCATTCAATCTGCTTTTGCACAAAA
CACTCAGTTATTACTTTAATCTTTGGCCTAAGTTAGATTG
CTGCATACTTGAATTTTTACTTTTATTTTTGGAAACTGCA
GCTTTTACACCTGCTTGTGTAGATGCTTTACTAACATTTT
ATTCAAATGACGTTTGAGAGTTTTCATGCAATATAATGCA
GTGTAAAAACACATTTTTTTCAAATATTACCAGCTGTACC
TCAGAAAATACCAAGCATTTTATAATATTTCTATACAAAA
ATCAACTCTCACTGAAGCCAGAGGTTTGGAATTATTTGCT
GCCTGTAGATTCAGTTCCTGACTAATGTGAATTCACCATT
TCATTTTAAGGATAATCCTACCTGCTCAATATTTAGAAAG
AACTGCATTAATAATAATATGCCTTTTAAAAACTATTTAT
GCTATTCTATGCACATGTTTATCTTTTTTAAATGGTAATG
TAATGGTTGATTTACTGTAATTTATTTAAATACCACTAGG
TGGTAGTACACATTGCCAAAAGCCATATTTGTACATTTCA
TCATCTTCAATGTTTTGATTGTACATAATAATTTTCTTTC
TGATCTTGCTGGTGTCTGTTTTCTGAAAACTACATGTAAC
AATTTATAGCAGGGATGCCCAAACTTTTTTTACATGAAGG
GCCAAAAAACAAATATCACTGAATTATTTTACATTAAAGT
TTCCATGGGTAATTTCATAATTAATTTTATAATATTTAAA
AATAGATAGAAATTAAAATTATAACTTTTTGCAATAAGAT
CATAAACATTCATAACACAGTGAAGTTTAACGCTGAATTC
ATTAGTCGAGCAGAATATGCCTTTGCCTCTATCTGTCGGG
TAACAGTGTACATTTTTAATTAAATCTGATTAAATGAAAC
CACTTAAATTGAAACCTTTCATTTCAGTTTGTGTAGCAAT
ATAACAAACAAATAAAAAAGTTAATTAAATTGGAAATAAA
AATCTCTAAATCAGGGGTGGCCAAACTTTTTCTTATGAAG
GGCCAAAATACAAACTTAATTGAGGCTAGTTGGCCGAAGG
TAAATATATTTGCTATGGGTAAATTCCTTATTTATTTAAA
AATATTTGAAAATAACTAGATAGCATTGCTTTATATTAAT
TAATACGGTACATATATATATATTTATTTATTTTTTAATT
TTTTTATTATTATTTTTTTTTTACATTTTATACTGAACTT
ATTACAGTAAAAACTAAAAATCTCATGGAGTTAAGAATCT
AGTTACACTAGTTGTTGCCTTGATTTGCTTTCCTATGTCT
TCTGCATAGTCCTCTATTTGTTGTGACAGTATTTATATTT
TTAAAACTCAGATTTATTTACATTTGAATTAAACATTTAA
TTTCAATTAGCTTTTTTGTAGCTTCGCAATAAAACAAACA
AACTAAAAAGGGTTATGTCAAATTAGGGCTGGGCGATAAA
ATCGGTATCAGTATTTATTGACAGAACACCGTTGTCAATA
TCGATTTAAAAAAAAATTGATCAGAAGTACGCAAGTAAGT
TTTGGTAGGACCAGGGCGGGGCCAAGTCGAAGCACTCACT
TTGGTCCCCTGGGCTCTGTGATTGGGAAATTCCAGATTGA
ACCAAAACAAACTTACAATTGGCTTAAGATTAGCAGTTAA
AGTTCAGGACATTGCAACCTGCAGAACCAGGGAAAAAAAG
ATGTTTGGGTATGAAGCGCTATAGTTTTATTAATTTGGTT
GCTAAGCTTGTCATGCGTACATGTGATAATTTTTTTTTTT
TTTGCAATATCGCCTTTCCCTATGTCTAATTAGAAATGAC
AATCTCTATTAAAGACATTGCCCCAATCCTTTCTATTATT
CTCAGATGGGATGGTGGGCCAAATCAAAGGTTACAATGGG
CCATCTTTAGCCTGCGGGCCCTACTTTGGGCATCTCTGCT
CTAAACCATTAGCATCATTCTCCCTCTCAGATAGGATGGC
GGGCCAAATCAAAGGTTACCATGGGCTTTATGGTTTATAG
TGTCCTCATCTCACTGGTGCTTTCATGAGTTCCAACAAAT
TGTTTTAATAATTTACATTTTGTAGATCTATTTAATTTTT
ATACAGTAATTACTTATTTAAAACTTAGCATATTGAATTT
TAACACTGGAACTGAACTTTTTATATGCATTATTGTTATA
TAAATTAATTGTGTGCAGTTTTTTACTATTACTGGCTTTT
GCTCAGTTTTCAACTGTGTATTTATAAATGCTTCCGTTTA
GTGTATTTTGAAATGTTTTTTTATGCAGTCACTGTGTATA
TGGCTCCTGCTTCAGCAAAAGGGCAATGAGATCTTTTTTC
ATGACTATGTTAAATCGATCAGTTACAAATATGTATTTTC
TTAATAAAACTGTGACGGCTTTAAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-79d12.5-201 Contained in:
OTHER si:dkey-79d12.5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048584 (1)
  • Ensembl_Trans:ENSDART00000153731 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT611069 (1) 863bp
    GenBank:CT664245 (1) 716bp
    GenBank:CT664244 (1) 689bp
    GenBank:EB768701 (1) 588bp
    CITATIONS (2)