Transcript

vsig10l-201

ID
ZDB-TSCRIPT-131113-3304
Name
vsig10l-201
Previous Names
  • vsig10l-001
  • ch211-231m23.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000047804 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047804|OTTDARG00000033905|ZDB-GENE-131127-231 vsig10l|OTTDARP00000037528 CH211-231M23.6-001 LG_ CU855686.17 Danio rerio protein_coding PUTATIVE, 1991 bp
TGGAAGTTATTTCCCCCATGTTTACAGGTCATCTGTGTTT
TCTGACCCTTTCACCTATGGGTCGAGTATCAATTCAAGCA
CTTGTGGGCACAAATGTGACTCTTGCTGTGTCCCACGCTG
GTGCGTCTCAGCCGGAGGTGATGTGGTTTTTGGGAAAACT
TCTGGTTGCTAAATGGACCGTTGGTGAAAGTTCACTTCCA
GATGCTGCTTCAGGTGTTTTAAAAGCAGAACAGGATGGAT
CTCTCACCTTCAGAAATGTGTCGATGATTTATAACGGCAC
ATATACTGTTGAAATGAATAAAATCGGGGAGGCAAAGGTC
AGCGCTACATTTGACCTCTTTATTTATGATCTCATCATGA
ATGTCTCCCTTCACACTGACTCAGACGACGCCATTGAGGG
TGAAGTGAAGTTCAGTTTATATTACAGCACAATTCAAGGA
GAGGCCAAAGAAGTCCAGTGGCTTTTTAATGGGCTCCAGA
TAAAAGATGGATCTCATTATTCCATCAGCGGGAAGAGACT
GACGATAAAGCAGCCCAGCAGGAACGATACGGGCCGATAC
ACTGTATTATTAACCAACCCGTTCAGCTCTGAGGATCATC
ACAGAAACATCACCGTTCTGTATGGACCTGATATGCCACT
TCTCAAGGTCAGTCCTACAAAAGCTGTCTTTGTTTCGGGA
GAGTCTCTGTTCCTCTCCTGTCAGGCCGACGGCGAGCCAG
CTCCTTCAAACACATGGACTTTCAATGGTGAATCCATTCC
TGCGTTTTCACCAGGAACAGTCAGTCTCACTGATGTAAAG
ACCAATCAAAGCGGCGTTTACACCTGCCTGATGATCAACA
GCAGAACTAATGCAGCACTCCAGAGAAACATCACTGTGAT
CGTCTATGAGTCTCCCAGCGGCGCCCCGCAGTGTTCGGTT
CAGACGGTGCCTGGAGGAGCAGCACTGCAGTTCCTCTGTG
TTTGGCCAGGGGGCGCTCCGGCAGCGCGAGTGTCTTTCCC
CAGCCTGAGCGATGCAGGTGGAGAGGGAGATTACAGCATC
ACTGTGCAGGACATCCACAAATTAAACAGACAAGAAATCA
TCTGCACAGCTGAACATCCGCTCAGAAGCACACACTGCAG
TGTCTTTCCCTCTGCTCCTGTGGATTTTCTGGCGGTAGTT
TCCACCAGTGTGAGTGCAGATGATCAGATGATGGTTCTGA
TGGTCTGCTCTCCTGAAGCCACACCTGAAGCTCTTGTGTT
CTGGATGAAGAGCGGAGAGCGCCTGCAGAATGACCACAAA
TACCAGATCAGCACAAACACAACTCAGCTCAGGATTCGGG
ATTTTAATGCCTCTTCTGCAGACCTGGACACCTACACCTG
CTCTGCTGTCAACCCTCTTGGAAACAAAACTCTGCACACC
ACACTGACTGGTCCTCAAATCTCCAACTCAAGTGTTTTGT
CAAATGAGGATGGTACAGAAGTTACTCTTACATGGGATGT
TCCTCTCACCTCTGTTATTACAGGCTTTGACATCCAGATG
AAAGGTCCAGAGTTTTCTCAGCCCGATGTGAACACAGCAG
ATTTCCACACTATACAGATAATGCCGGCGTTCAGCAGAAG
CGCAGGCATCTCTGCACTCGACCCTAAATCCACATACTAT
TTCAGAATCATCCCTAAAGCCGGCAGAACTGCAGGAGAAC
AGTCGGAGAACCATCGCATCGGGCCAGCTGCTGAACTTAG
TGTTGCTGCCGTCGCTGCTTTATCTGCTGGAATCCCCTGT
GGTCTGCTTCTGCTCTTCATCCTTATCGGCTTCATCTACT
GTGCGACTCAAGACCGAAGATATCCAGTCTCCAGAGCCGT
GGAGAAGGTTGTCGTCTCTCAATCGGCTCTCAATCCTCAT
AATCTCCTGAGAGCAAGATTAAAAACCCCAGCAGATGACA
GACTCCAGCAGCCTGAACGAGCCGATCCTGTGTCTTCAGT
GGACTCGTCTGTGCGAATGACCACCGCTGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations