Transcript

si:ch211-231m23.4-202

ID
ZDB-TSCRIPT-131113-3303
Name
si:ch211-231m23.4-202
Previous Names
  • ch211-231m23.4-001
  • si:ch211-231m23.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000047801 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047801|OTTDARG00000033902|ZDB-GENE-131127-603 si:ch211-231m23.4|OTTDARP00000037525 CH211-231M23.4-001 LG_ CU855686.17 Danio rerio protein_coding NOVEL, 867 bp
TGGAGTGCAAAAATGATCAACCAGTGGGTGATTTTCGCCG
TCTACGTCCTGACGTTTCTAATCGGCCTTCCAGCGAATCT
TCTGGCCATCTGCACGTTCATTAAAAAACTCGGAGACAAA
CCCAGTCCCAACGACATCCTGCTCTTCCACCTGACCACTT
CAGATCTGGTCTTCCTGCTGTTTCTTCCCTTCAAGATGTA
CGAAGCCTTCATGGGCATGAAATGGCACTTACCGCAGACC
CTGTGCTCCATCGCCTCCTTCTTCTTCTTCACCACGATTT
ACACCAGCTCTCTGCTGCTAATGGCTATAGCTGTGGATCG
CTACTTAGGACTAGCCTTCCCGTTCAAATACCGAATGCTA
CGTAAACCGATTTACGCCACGGTAGGTTGTGTTTTTATAT
GGCTAGTCAGCGCGGCTCATTGCAGTATCGTGTTTATCAT
CGTTCATATGCCGGATCAGAACACAAACGGATCGGTTTGC
TACGAAGAATTTACTGAAGAGCAGAAAAGGATCTTGCTGC
CAGTTCGGCTGGAGTTTTTTGTGGTCATTTACACGCTGCC
GCTCCTAGTTTGTGTCTTCTGCTACATTAACTGTATCAAT
ATATTGTACAGCAGGCCTCATATTGTTAAAGTGAAGAAGC
AAAGAGCCATTGGGATGGCGTTGTGCACACTTACCATCTT
TTTACTGTGTTTTTTACCTTATAACCTGTCGCATCTAGTA
GGTTACAGCAGCAATAAAAGCCCGCCGTGGAGATATTACA
CGCTTTTGCCGAGCACACTCAACACTTGTCTTGATCCCTT
CGTCTTTTACTTTTCATCCTCAACTTTCCGCGAAAGCAAA
ACAGTTTCTTTGCTGAAGACGTGGTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations