Transcript

si:ch211-1i11.3-201

ID
ZDB-TSCRIPT-131113-3293
Name
si:ch211-1i11.3-201
Previous Names
  • ch211-1i11.3-001
  • si:ch211-1i11.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047757 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047757|OTTDARG00000033875|ZDB-GENE-030131-8638 si:ch211-1i11.3|OTTDARP00000037491 CH211-1I11.3-001 LG_ CR376777.22 Danio rerio protein_coding NOVEL, 3474 bp
GAGGACGCGCTCACAGGATGATTTTTAACCATCTAGGTGC
TATTTTATGAGATAACACCATGTATACGACTGAACGTAGG
CGCATGAGCCTGCACGAAACCAAGCGAAAAGATCCCGTCC
GAGTTTCAGCTGGAAGTTTGTGGCAGGATCCTTTGGCTCT
TGAAGTAGGTGGCGCGGGTAAAAACGTGATATCGCCGAGA
AGCCGGACCAGGGCTTTGTCTGTGGTGTACATCGCGGTCG
AGGACGGGTCTTTGCCCCAAACTGAGGAGACACTTTCACT
GAAATGTCTGACTGAAGCTTGCGCGGACGCTCACGCGGTG
CTGAAGAGCATTTCCTACGAGCGCATTGCACTGGGCACCA
CCGAAATCCTGGACACTTTCTACAACGCAGATGTGGTTGT
TGTGGAGATGAATAACTCCATCTGCCAGCCATCTCTGTTT
TATCACCTGGGTGTCAGAGAGAGTTTCAGTATGACCAACA
ATGTCATCCTGTACTGTAACAAACAAGAAGACGATATGCA
AGTTGTGAAGGAACAATGTGGGAGCTACACGTTCATCCCC
TACATGGTGTCACCACAGGGTAAAGTGTTTGCCTGTGATG
CAGCACTGATGAGGGCAGTCAAAGATTTCCTGCATTCCAG
CTTTAAATTTGAATCCCTGATGACATCTCTGGTGGATCGA
CTGGTCAAATTACTGGAAAGCGTTCACATTAATTCTAGCG
AATATCTCCATGAGGCAATCCGTAGGGAGATCCGTCTGGC
TCGAGAACACTTCACTGGCCCAGCTTTGAGTCAGGAGCTG
GGACGGATCCAGAAGCGTCTGGACTCTGTGGAGCTTCTGA
GTCCAGATATTGTTATGAGCCTCCTGCTGTCCTACAGAGA
CATTCCAGACTACGACTCCATAATAAATCTGGTGGAGACC
TTGAATAATTTGCCCATGTGCATGGTGCCAGCACATCAGA
ACATCAAATTTCAGTATATATTTGCTTTGAACAGGAGGAA
TCACCCTGGTGATCGTGTCAGGGCTTTAAAGCTCATTTTA
CCCATTGTGGAGTCAGGGGAGACGGTAGCCTCAGATGTGT
ACTGCCTGTGTGGACGCATCTACAAGGACATGTTCCTCAG
TTCAGGCTTCAAAGACACAAACAGCAGAGATCAGGCATCT
AAATGGTATGGCAAGGCCTTTACGATTGAGCCCAGTTTAC
ATTCTGGAATCAATAACGTTGTGCTCCTGATGGCCGCTGG
GCATGAATTCGACACTTCTATTGAACTGCGAAAAATCGGT
GTTACCCTCAGTAGTCTGCTGGGCAGGAAGGGCTCCCTCG
AGAAGATGCAGGACTACTGGGATGTGGGATTTTATCTGGG
AGCTGGAATCCTGGCCAATGAACACAAGAAAGTCATAGAT
GCTTCAGAGAGACTCTACAGGCTCAAAGCTCCAATGTGGT
ATGTTGCATCCATTATGGAGACGTATATACTCTACAAGCA
GTTTGCCAAACCCAGAGAAGTGAATCATCCTAAACAAGAA
ACTGCAGACTTTTGGATGGAGTTGATGGTACAAGCATGCA
AACCTACCGTTTCCACAGCACGATGCCCAGTTCTGATTCT
GGAGCCCACTAAAGTCTTCCAGCCCAGTATAATAAGCGTA
AGTGAGGAAGACGACAGCCGTACGGTGCAGCTTAGACACG
TCACTCCACTCGAGAAAGGTCTTCACGAGTGGACTTTCCC
AGCATCTGCGATTCGTGGAGTGAGCATTTCCAAGTTTGAC
GAACGGAGCTGCTTCCTGTATGTCCTGTACAATTCAGATG
ACTTCCAGTTGTACTTTCCCAGTGATCTGCATTGCAAAGG
GTTCTGTGATTTAGTGAACTCGCTGTTGCATCAAACCGAA
AGTCCTGTGGAGGATTCCAGTTCAATGAGGGGAGAGGAAG
GAGATTTAGAGTACATTTATGAGAGGAATGAGAATGGAGA
CAAAGTGGTGCTGGGTAAAGGAACCTATGGAGTGGTGTAC
GCTGGACGGGACCTCAGCAATCAAGTGCGCATCGCAATCA
AAGAGATTCCAGAGAAGGACAGCACCTACTCTCAGCCGCT
TCATGAGGAGATTGCTCTGCACAAGAGGTTAAAACACAGG
AACATTGTTCAGTATTTGGGCTCAGTCAGCGAGGATGGCT
TCATCAAGATCTTCATGGAGGAGGTTCCTGGAGGAAGCTT
GTCGTCTCTATTGCGATCAAAATGGGGTCCTCTTAAAGAT
AATGAAGCAACCATTGTCTTTTACACCAAGCAGATACTGG
ATGGATTGAAATATCTCCACGATAATCAGATCGTCCATCG
AGATATTAAGGGTGATAATGTTTTGGTAAACACATACAGC
GGTGTGCTTAAGATATCCGATTTCGGCACCTCTAAGAGAC
TAGCAGGAATCAATCCCTGTACAGAGACGTTCACAGGGAC
TTTGCAGTACATGGCTCCAGAGATCATCGACCAGGGGCCT
CGTGGGTATGGAAAACCGGCTGATATCTGGTCTCTGGGCT
GTACTATCATTGAAATGGCCACCGGAAAGCCACCCTTTCA
TGAGCTGGGAAGTCCTCAGGCAGCCATGTTTAAGGTGGGC
ATGTTTAAGATTCACCCTGCAGTGCCGGAGTGCATGTCAG
AGCAAGCCAAAGACTTCATCATGTGCTGCTTTGAGCCAAA
CCCAGACAAGAGAACCACGGCATCAGAGCTCCTGAAGAAC
GGCTTTCTGAAGGCCAGTGCCAAGAAGAGACTAAAACCTC
TGGCGGACAACAGTCTGAAAGAACCTGCCGGAGAATTTCA
CAGGAGCATGTCGGTTCCTGTTGCGTTGCGTGTGGAGAAC
ACAGATGTGGAGCACAATGAACTGTCCTGCTCTTTTGATC
TGAGAAGAGCCACTTCTGCCTTCAAAGGAAACAATATGGC
TGAAAGTCCTCCGAGCACCAGTGGCTTCCTGACAGTGCCA
GATGAGCCTCAAATAGACATGACCACAAGTCCATCAGGTT
CTGGAGAGAATCTAGGCCTGTTCATGCTCAGAAAAGACAG
TGAGCGGAGGGATACGCTACACAGGATCCTTACAGAGGAC
ATCAGCCATGTAGTTCAAAACATTCAGGAAACAATGCCGC
AGGCGGAGGAGCCGTGCATCACCTCAGATCACATCAGCGA
GCTGATCGGCTGCCTGCGAGAAAACATCCGCTCTCCAGAC
AAAAGACTCCTGACCAACAGCCTGCTGACTTTACGCTCCA
GCCTTTTAAACTCCTCTGTGCCTCTCAGCAGCCTGCAGGC
GGTGCTCTTCAGCTTCCAGGATGCCGTCAAGAAGGTTCTG
AGGAAACAGCAGATTAAACCTCACTGGATGTTTGCTTTGG
ACAACTTGCTGAGGCAGGCTGTACAAGATGCAATCACAGT
TCTGCTCCCAGAGCTCAAGCTTCAGCTGCAGTCTTCATTT
GAAAACGAGGAGGGTTCACCAGAAACCGAGCATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations