ZFIN ID: ZDB-TSCRIPT-131113-3279
Transcript Name: spag1b-001
Previous Name: ch1073-194e19.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047702 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047702|OTTDARG00000033846|ZDB-GENE-061013-512 spag1b|OTTDARP00000037462 CH1073-194E19.1-001 LG_ CU855932.4 Danio rerio protein_coding KNOWN, 829 bp
GACAACTCTGAACACACTGCATCAGAGCTGGAGCTCCTGA
GGCATGATGGGAAGGTTCTGTTCTGCAGCGGCTGCTATGA
GGAGGCAGCAGAGAAATACACACAGAGTCTTCAGCTGGAC
ACACACACCTGCGCAGCGTACACCAACAGAGCGCTCTGCT
ACATCAAACTCGAGCGCTTCACTGAAGCCCAGCAGGACTG
TGACTCCGCCCTTCAGATCGAACCCACCAATAAGAAGGCT
TTCTACAGACGAGCACTGGCCAATAAGGGTCTGAAGGATT
ACCTGTCGTGTCGTTCAGACCTGCAGCAGGTGTTGCGTCT
GGATGCGAGTGTGACGGAGGCGCAGCGGCTGCTGATGGAG
CTCACACACCTGATGGAGGACAGGAGACGCATGACTGTAC
ACATCACTGAGGTGGAGGATGAAGATGATGAAGGTGTGGT
CAGCGGTGCAGATTGAGCCGTGGAGAGTGTGTGTGTGTGT
GTTGGGTCAGATTCTGGTCCATCCGTCGCCATGACGACCT
GCTGACCCGCGGTGACTCAAGGACAAAGCATCACAGCTAA
CACATCACGCCTAGCAGGACTGATGAAGGAGAGCTGCAGC
GGTAGTGTCCATCCCGGAGGATCCTCTATAGCTCTGGAGT
TCTTCATCAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
AATAAACGTGTTCATGAATGCAGTACGAGTGCTCATGTGT
TCACAGATATGAAAGCTGATTGACTGTTTCTCGATATAAG
ACTATTATAAAGTATTATTGCATCACTGA

spag1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA spag1b-001 829
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
spag1b-001 Contained in:
[Fosmid] CH1073-194E19 (1)

Genome Resources: Vega_Trans:OTTDART00000047702 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BQ419621 (1) 649 nt
GenBank:BQ419838 (1) 581 nt
GenBank:AL925082 (1) 530 nt
GenBank:EB878872 (1) 382 nt
CITATIONS (1)