Transcript

si:ch211-79k12.2-201

ID
ZDB-TSCRIPT-131113-3257
Name
si:ch211-79k12.2-201
Previous Names
  • ch211-79k12.2-001
  • si:ch211-79k12.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046730 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046730|OTTDARG00000033267|ZDB-GENE-131121-535 si:ch211-79k12.2|OTTDARP00000036814 CH211-79K12.2-001 LG_ CT867948.10 Danio rerio protein_coding PUTATIVE, 1869 bp
CCCGGAAATACACTGCTGTGGCTGGGGGAAGATGGCGTTA
TGAGCGGCTCCAGACAGAGTAACAAAAAGTAGGGCAATAG
ACTCAAGAATTAACTATTAACCAGCGTTTAAGCTTCACAA
AAGGACAACAAAGCCCAGCCTTACATAAGTCATAAATGTA
TATCAATATAGCCGCTCGCTGAATTATGTGAGGGCTCGCC
ACAGATGGACAAAGACAGACTCGCAGCTGGTCCATGCTCA
TGGCTGGATATGCATCATTTTATTGGTGACCTTATGGCAG
CCAGTGCTACAGTCACTGGTCATCCAATGGCAGAGCGACG
TACTGAGGAGACACTAAGTTCTTGGCCCAAAGTCCCTCAT
CCTCCTCAGTCCATCCCATCGAGACAGAACCCTGTGAAAA
ATGCTGTTCGGTTTGGTGTGCAGTCTGAGGAAAGGGAGCC
CAGACATAATGAAAGCCATGCTCACCGACGCACCTGCACA
TGTCCAGGCTGCCCTCTTTCCTCAACTCCCTCTAGTTCCT
CATTTCAGACCCTGAAACCCAAAGCCAGCTCGGCCTCACA
GATCCAACCACCTTCATCCACACAGTCCACCCCACTGCAG
CAGGCCAAAGAGCCCAGCACTGCCCCGGTCAGCTTGGGCT
TGTGTCTAGGTTTGGGTCTCTCTCTGGATGAAGAAAACAC
CGGTTCAAGCAGCACATCTCGTCCCCCCCAGCAAGAGGAC
AAAGGCACCAGCACTCATAGCCCAATCCCCCAGTCAAATC
CAGAGTCCCCAGGTGTTTCACCTGCTCAAGCATTTCCATG
TGTATGCTGCCATCGTGGGTTTCAAACTTGTAGCCAACTT
TTATCTCAACAAAAGGACCCAGAGTCACAAATTGCCCACC
ACTACTACCATCACCACCATCATCACTGTCCGCTCAGCAG
CTGCACGTCATGTACACACCCTTCATTCCCTTGCCTGTCC
TGCCAGCGCACCTTCCCCACATGTGCCCAACTCCTGCGCC
ATGAGCAGGGTCATGCGCAGCAGGATGGCCTGCAGCAGCT
CTCATGCATGCACTGCAATGCCTCCTTTCCACGTCCGTCA
CAGCTGCTGCAACATCAGCGCACTCAGCACGCAACTAAAG
CGGGTGGCTTTCTGTGTGCTGAATGCGGCCGTGCGTTCAA
TTCACACAGCAATCTGCGCATCCACCTCAACGTGCACACT
GGTGCCCGGCCATACATCTGTACCAACTGCGGAAAGAGCT
TCAGCCAATCTGGCGCCCTTAAGATTCATCGCAGAATTCA
CACCGGAGAGAGGCCGTACACCTGCTCATACTGCGGGAGG
GGATTCCCTCACCTGGCTGGGGTGAGAGCTCATCAGCGCA
TTCACACTGGTGAGAAACCGTACATCTGCGGTCAATGTGG
AAAGTGCTTCACTCAATCTGGAGCTCTGAAGATCCACACT
CGCATACACACCGGGGAGAGACCTTTCGTGTGTGGTCTCT
GTGGGAAGAGCTTTTCCAACCGCTCCGGCATCCGCTTTCA
TCATCGCACGGTTCATGGCATCGTAATGGAGCCCAACTCT
GTGGGCAGGCCTAGCCTGGCTGCTTCTGCTTCATCCCAAG
TTTCAGACATCCAAAGAGTTCAAGTCTCCGCTGTCAACCA
GATTCATTTTCGGCAAATAGAAGAAAGGAATTTGCCAAGT
AAAGAGTTGGTTCAGCCCAGTAAAGAGCAGTTAAGTGGGA
ATGCGGACAAATTGGCCCTTCCGTATGCCTGTGAGGATTG
TGGTCAGCGCTTTCCAGATGCTCCTTCTAGAAACAGACAC
CAGACGCTGCAACACTACTCTCTGGAGGAGCAAGAGAAAG
AAGACACTGGCTCTAGTAAAACTAACGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations