ZFIN ID: ZDB-TSCRIPT-131113-322
Transcript Name: mafga-201
Previous Names: mafg-001, mafga-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051845 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051845|OTTDARG00000036414|ZDB-GENE-040624-7 mafga|OTTDARP00000040737 mafg-001 LG_ CU633742.6 Danio rerio protein_coding KNOWN, 592 bp
AACTCTCTTTGAATTCCCAGACCTGTTGAGCAGGGCAGTG
GAGAGCAGCATTCGTGGTATGACTACTACAAACAAGGCAA
ACAAAGCACTGAAGGTGAAGCGAGAGCCAGGTGAGAATGG
CACGAGTCTTACAGATGATGAGCTGGTGTCCATGTCTGTG
CGAGAGCTGAATCAGCACTTGCGTGGTCTGACCAAAGATG
AAATCCTGCAGTTGAAACAGAGGAGACGCACACTTAAGAA
CCGGGGCTATGCTGCCAGCTGCCGCGTCAAACGTGTCACT
CAGAAGGAGGAGCTGGAGAAACAGAAGGCAGAGCTTCAGC
AGGAGGTGGAGAAGCTCGCCTCTGAGAATGCCAGCATGAA
AGTGGAGCTTGATGTTCTGCGCTCCAAATACGAGGCTCTC
CAGAGTTTTGCTAGAACTGTGGCCCGCAGTCCAGTGGCAG
CTGCCAGGGGCCCTATCACATCAGTCATAGGGCCCCTCAT
ACCAGGCAAAGTTGCTGCCACCAGCGTCATCACCATTGTC
AAGTCTAAAACAGAAGCACGGTCATAATGCACAAACGGAG
AACATTTTTTAAGTATATTGGTCAGTGTGTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mafga-201 Contained in:
[Fosmid] CH1073-300I13 (1)

Genome Resources: Vega_Trans:OTTDART00000051845 (1),  Ensembl_Trans:ENSDART00000154274 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AB167540 (1) 594 nt
GenBank:BC163141 (1) 544 nt
GenBank:BC163157 (1) 544 nt
CITATIONS (2)