ZFIN ID: ZDB-TSCRIPT-131113-3201
Transcript Name: foxk1-201
Previous Name: foxk1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018427 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018427|OTTDARG00000015377|ZDB-GENE-030131-6402 foxk1|OTTDARP00000015556 foxk1-001 LG_ BX649536.8 Danio rerio protein_coding KNOWN, 3200 bp
TGCGTCATGACGTCACTTCTTCAACCACGTCACATTATTT
TGACCTTCCAAAATGTTTTTCATATCGACCGAGAAGTACC
ACACACGAAAAACGACATGTAAAAGTTACGATTCGAGCAA
CCGCGCTTGCAAAGGACTTCAAATCAAGCTCATTTTTATT
GCCACATGTAACGCACGTGTCGTCCGGTTCCAGGAACTGC
AACAACATTAACCTTTAATTTGCCAAAGAGCAGAGAGTTG
AGAATCATCAGGCAATTGCCACGCTTATAAAACAAAGCAG
ATTAAACTTACAAGAAATATCAGGGACATCCCATCACTCC
CCATTCCCTGTTTCAAAACGACTAAATGGTTTATAAGCGA
TTAAAACACGCGACGCTCCGGTCCGCTATTCCATGACGTG
TTTTCCGCGCGCCGTCTCCATGTTTTGACTACCACCACCA
ACAGCAACACAGTGAACCCTGCCAACACATAGCCGTTGCG
CTTGCAATCCCCTCTGTGTTTTTCAACAAAATGGCTGATT
TAGGGGATGATACCGGAGCGAGAGCCTTACTCGCCCTCAA
ATCTGCGCCTTGTAGCCCGGTGGCCGTGTCTATCCCGCCC
GTGTACACGCTCTCCTCCTCGACTTCGCCCGGGATCACAT
CATCCATGCCCCTCTCCTCTCCGTCGCAGGCCCTCGCCCG
CCTGGAAGGCAGGGACTTCGAGTTCGTTATGCGCCAGCGG
ACGGTCACCGTGGGCCGGAATTCCTCGCACGGCTCCGTGG
ATGTCAACATGGGCCACTCGAGCTTCATTTCCAGGCGACA
TCTGCAAATCGCCTTCGAGGAGCCGCATTTCTACCTGCGC
TGCCTCGGCAAGAACGGTGTGTTCGTCGACGGCGTTTTCC
AGAGGAGAGGCGCACCCCCGCTTGCCCTGCCGAGGGAGTG
CACATTTCGATTTCCCAGTACGGTGATCAAGATTCAGTTT
ACCTCGCTCTACCATAAAGAGACACAAAAGGAGGAGGCTC
CTGTATCCCCTGTGAGACCTCTTTACCCTCAAATCTCTCC
GCTGAAAATCACCATTCCCGACAACGACTTCAAAACTATG
ATGAGTCCCCTGCCTTCACCGACAGGAACTATTAGTGTTC
CCAATTCCTGCCCAGCAAGTCCTCGAGGAGCAGGTTCCTC
GGGTTACCGATACGGCCGCAACATCACCTCAGATCTCCAG
CTGGCAGCGGAATATGCAGCCAAAGCTGTATCAGAACAGC
GCACTGAAGCCACGGGAGGAGATAGTCCTAAAGATGAGTC
CAAACCCCCATATTCATACGCTCAGCTGATAGTCCAGGCC
ATCTCGTCTGCACAGGACAGACAGCTAACACTAAGTGGCA
TTTACGCTCACATCACCAAGCATTATCCTTACTACAGGAC
GGCCGACAAGGGCTGGCAGAACTCAATCAGACACAACCTG
TCTCTGAACCGCTACTTTATTAAAGTGCCGCGCTCGCAAG
AAGAGCCTGGCAAAGGTTCATTCTGGCGTGTGGACCCGTC
ATCTGAGGCCAAGTTGGTGGAGCAGGCCTTTAGAAAGCGC
CGTCAGAGAGGAGTGTCCTGTTTCCGCACCCCCTTCGGCC
CCCTGTCCTCCAGGAGCGCTCCAGCTTCTCCCACTCACTC
CGGCCTCCTCTCTCCACACTCGAGTGGCCTTCAGACCCCT
GAGTGTCTCTCCCGGGAAGGATCCCCAGTGTCTCATGAGC
ATGACTTTGGTTCTAAGCTTGCCTCTGTGCCTGAGTACCG
ATACTCCCAGAGTGCACCAGGCTCTCCAGTGAGCGCTCAG
CCAGTAATCATGGCTGTACCATCTCAGTCCTCAGCCGCGA
TATCCAAACCTGTGGCTTACATGCCCTCCATCATCAGCTC
CTCCCAGGCCTCTGGTCAGGCCATCCATGTGGTGCAGCAG
GCGCCAGCTGTCACCATGGTCCGTGTAGTGACCACCTCAA
CCAGCTCCCCTAATGGCTACATTCTGGCCAACACCTCCTC
CTCAGGCCCTGGAGACCTACATGGAGATCCAAGAGGTGCA
TTAGATGAGATGCCATTGGTTGGCAGCCGAGTGATTCAGG
CTGTAGGGAGTCACATAGCCTCAGCCAATAGGGGGCAGCA
GAGCTACACTGTTGTCCAGCAGAGCGCCATTCACCATCTC
CCCGTGCAGACCATTGCTCAGAATGGCAAACATGCTCTTC
CTGTCACCAGCATACCAACCAGTGCTTATGCTCTGACCAA
CCCTCTCCAGATCCTGGCTGCCCAGGCCTCAACATCCCCA
CCCGTGCTGGTCAACAGACCCTCCAGCATGGAAACTGACG
AGTCCAGCATCGACGAGCCCGAGCCCAAGCGGCCCAAAAA
GGAGGAGGACTGTGTGGCTCCGGTCCCTCAGCCTGTTATT
GTTGCAATGAACCAGGAAGCCAGCGAATGAAAGCGTGAGT
GAGCCAATGAGCGGATGACGGATCTTAACAGCACATCTCA
CAATATCCTCAAACATATTGAGGGCAATGTGTTGGGCTTT
CTTTAAAAACCTGAACTTCAACGTTTTGTAAACGCCCCAC
ACGGGCACCTGATCGAATGTCTTTGTAAGAAGAGCTTGTT
TCATGGGATAGATTCATCAAGCTACATCTGGCAGCATTAA
ATTCAGTGCTCACACTGTTTTAATTTTGTAGGGGTTTTTA
AATCTTGTAAGAATGTTTGAAAGAAGAGGTACATGTGCTT
AAAGACACCAGCTAGGCATGTGAACTTGTGTTTTCCTCAC
AAGTTACAGCTGAGAGAGCGAAAGACGGAGAGAGTTCATT
CGGGATGGGGTGGGACCAATACCTATGCAGCTATTAAAGT
CCGAGACCACGAGTCTCTCTGAATTGAAGCAGTATAATAA
AAACAAAAAATAAGGGTCACATGGAGCTGTGCGTCACTGT
GCCGCCTTTGTGAGGATTTATTTATCTCTCTGTTTAAAAA
CAAAAAACAAAGGCCATCTTTAACGAAATAAGATTGTTAC
AACTAAAAGCACATAAACGAATAGGCCTTTTCTAGCTGGA
GTTCTTTAACCTACATTGTTATAGTATACAATATATTTTT
CTGTGGAGGCTTCTTACCTTGCTTGCTTGATTTCCTATGA
AGAGAAATGTCTAGAAAAATGCTAACTTCTTAATTGGTCT
GTGTTTAGCGCAAACAATTAAAAAGAACTCAATGAATGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxk1-201 Contained in:
[BAC] DKEY-21N8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000018427 (1),  Ensembl_Trans:ENSDART00000055201 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BM890480 (1) 640 nt
GenBank:AW233561 (1) 442 nt
CITATIONS (2)