ZFIN ID: ZDB-TSCRIPT-131113-3156
Transcript Name: ottdart00000059965
Previous Name: ch211-46e8.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059965 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059965|OTTDARG00000041592|ZDB-GENE-010403-1 crx|no_translation CH211-46E8.2-001 LG_ BX927323.5 Danio rerio antisense NOVEL, 825 bp
TGACCACAGGACCAGTAGAGGGAGCTGTTTCTTTCCTACG
GGATTCAACAACCGCGAGACATAGCACCTGGAATTTGTGG
TCGAGGCAGTCCACAGTGCTGAAGTTGAGCTTCCAGGCCT
GCTGGTCCTTGTAGTCAAGGCAGTCTACCGAACTGAAGCC
CAACGACGCAGTGCTGTATCCCTGGGAGGAGAGAGAGGGC
GACTGGCTGAGCGAGCCGCCCATGGAGGGCACGGTGAGGG
GGGAGAGGGCGCCTCCACTTGCTGACAGCTGGGTGGTCAT
GGGAGAAAGGTACGGGCTGCAATCCAATCCGCTGAAGTAA
GGAGAAGAGCCATAGCCCTGGCTGTAGGAAGAGGGCTGAC
CGTAGCTCATGGGATATGGAGCAGGACGCTGCACGCAGGG
GGTGCCTGAACCACACAGTGGATCAGGGAGGGGGGAAAGA
GAAGTGGGACTCCATACAGAAACTGGTGCTGTGCCTGCGC
TCACACTAGGGGGCACGGTCGGGGTCGGGGCAGCCACCAC
CGAGGAGCTAGTGCCAGGGTCAGAGGTCAGATCAGGGGGA
GGGGAGGACTTCTTTTTGGGGGGACGGGGCTTGGGCTGAC
CGCTGGTCTGCTGCTGCTGCTGGCGGCATTTAGCACGACG
GTTCTTAAACCACACCTGAAAAAAAACAATGGAGTTATTG
ATGGATTGTTTTAAGACAAATTTGGGTAAAATATAAAAAT
ACAAACTTTTTTGTGTTAAAAATTAGTTTAGAAATTTAAC
CAAATGGCTGGCTTATTTCATTGCAGATCAAGGAATGAAT
ATACTATAGAAACTATCATCTCATG

crx TRANSCRIPTS
Type Name Length (nt) Analysis
antisense ottdart00000059965 825
mRNA crx-201 (1)    Ensembl 2381
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000059965 Contained in:
[BAC] CH211-46E8 (1)

Genome Resources: Vega_Trans:OTTDART00000059965 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)