ZFIN ID: ZDB-TSCRIPT-131113-3114
Transcript Name: si:dkey-18f23.11-001
Previous Name: dkey-18f23.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059824 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059824|OTTDARG00000041487|ZDB-GENE-131121-442 si:dkey-18f23.11|no_translation DKEY-18F23.11-001 LG_ BX465853.12 Danio rerio antisense NOVEL, 350 bp
TGAATGTGGAGAATGAGATGTCACTGATGAAAACTAAAAT
TCAGAAACCAGCACCACAGCCATAAAGAGAGCCATCTCAT
CTGACTCCAGGCCCAGAGAGCTCAGCTTGGAACTGAACTC
AAACATGGCGTCCAGCAGTGAGCCCATGCCCAGACCCCTG
AGGGTGCCCAGCGGGTACGTCTGCCCATTGAGGAAAGTCA
CAGATCTTTCCTTGTGGTTGAACAGTGAGCAAAACCTCAC
CATAAGCACCTGCAAAAGACAACAGGATATGATGAAGGTT
AAAAAGTGAACCCAGGTGAGGCACGTTTTGTTTTTAACTC
TGAAAAATCTTGATTAAATCTATATAAATA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-18f23.11-001 Contained in:
OTHER si:dkey-18f23.11-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059824 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)