Transcript

galnt18b-201

ID
ZDB-TSCRIPT-131113-3039
Name
galnt18b-201
Previous Names
  • galnt18b-001
  • ch1073-395o3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059515 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059515|OTTDARG00000041243|ZDB-GENE-091014-1 galnt18b|OTTDARP00000046365 CH1073-395O3.1-001 LG_none FP325106.4,FP325131.5,FP325128.3,CU539052.13,AL808121.7 Danio rerio protein_coding PUTATIVE, 2745 bp
GCACACACTCGCGCACCTTCGCTCTGCTTCTTCCACACCG
TTGCTCGCCGCCGCAGATGGAGGACGCGCCGCTTCGTGTC
GGAACAAGACGATAGTCGCACATTTTTGCACATTTCTAGT
GTCCGGAATCTGTCAGGGCTGATACAAAACATGAAGCTGA
GACTGTAACGTTTGCTTCAGACGCGTGATTCTCCATCCAG
AGTCCATTCAGAGTTGAGGGCAGGCGCACTTGTCCGCTGT
GTCTCGGACTCTATATGGAGGGATGTCGGAATGGCTTGCA
CCAGAAGAACCAAAACTTTGGTGTCTACGTGTGTGATACT
AAGTGGCATGACCAACATTGTGTGTCTTTTGTACGTCGGA
TGGGTGACTAATTACATCGCTAATGTGTACATCAAAGTGC
CGGTGCCTGTCCCGGCCAAAAAGTTGGAAGGCGACAGGAA
AGGAGAAACTCTGCGGATTATAGAGCGACTGGATCGGCTG
GAGAATGTTGTCAATCAGCATATACAAGAGTCGCCACTGA
AAGGAGATGACAATCAAGTGGATCGATCTTTTGCTGACTC
ATCCTTGTTTAACCACTGGGGCCAAGACCTGGGGCCTGAG
AGCCGTCGAGTGGCCCTCAAGATGTTTCAGTATTACGGCT
ACAACGGGTACCTCAGCGACCGCCTCTCCATGGACAGAGC
CATCCCAGACTACAGGCCGGACGGGTGCAAAAACATGTCT
TACCCGTCCAACCTGCCACAAGTCAGTATAGTCTTTATCT
TTGTGAACGAGGCGCTGTCGGTCATTCTGCGCTCCATCCA
TTCAGTCATGAACAGAACACCCAGCCACCTGCTCAAAGAG
ATCATACTGGTCGACGACAACAGCAATAACGATGAGCTAA
AGGAGAAGCTGCAGGACTTTGTAAAGGAGACCAACGCTAA
GCAGCCGGGTTTCATTAAGGTGGTCCGTCACAGTAGGCAG
GAGGGTCTGATTCGCTCTCGAGTGAGTGGCTGGAGAGCCG
CCTCTGCCCCTGTAGTGGCTCTTTTTGATGCCCACGTGGA
GTTCAACATTGGCTGGGCTGAGCCTATTCTCCAAAGGATC
AAAGAAGACAGAACCAGAATTATATCTCCATCTTTTGACA
ACATCAAATACGACACATTTGAGATTGAGGAGTATCCCCT
CTCCGCTCAGGGCTTTGACTGGGAGCTGTGGTGCCGCTAT
CTGAATCCACCCAAATCATGGTGGAACCTAAACAACAGCA
CTGCTCCAATCAGGAGTCCGGCTCTGATCGGCTGTTTTGT
GGTGGACCGGCTGTATTTCGCAGAGATCGGTCTGCTGGAT
GAAGGCATGGAGATTTACGGAGGAGAGAACGTGGAGCTGG
GCGTCAGGGTGTGGCAGTGTGGAGGAAGTGTGGAGGTGTT
GCCCTGTGCCCGCATCGCCCATATCGAGCGCGCCCACAAA
CCCTACACAGAGGATCTCACTGCCCACGTGCGCAGAAACG
CTCTGAGGGTTGCAGAAGTGTGGATGGACGAGTTTAAAAG
CCATGTCTACATGGCCTGGAACATTCCACAAGAGGACTCA
GGGATAGACATCGGTGACATCGCCGAAAGAAAAGCACTGA
GGAAAAAGCTGCAGTGCAAGACCTTCCGCTGGTATCTAGT
GAACATTTACCCCGAGATGAGAATGTACACGGACACCGTC
GCATACGGAGTGCTCAGAAACTCTTTGAAGACTGACCTGT
GTCTCGACCAAGGGCCAGACACCGACAACATTCCCATCCT
TTACCTCTGTCACGGGATGACACCTCAGAATGTATACTAC
ACCAGCACTCAGCAGTTATTTGTGGGCATCCTGAGCCCCA
CCGTTGACGACGATGACAACAAGTGCCTGGTGGACGTGAA
CGGCCGGCCGCGGCTCATTGAGTGCAGCTACGCTGTGGCC
AAACGCATGAAGCTCCACTGGCGTTTTACTCAGGGAGGCT
CCATCCAGAATACAAAGTCAAAGCGATGCCTTGAACTCGT
GGAGAACAATGACAATGAGTTCGGATTTCAGCTCACCCTC
CAAAAATGCACTGGCCAGAACTGGACCATCACCAATATGT
TGCCTGGTAGCACCTTATGATGACTTTCGAGACCTGGGAC
GGCATTGAGAAATGAAGCACCTGGATGTCTCTGACTTTGA
CATCATATGATAAATGTTAAACATTTTTCTCTAGCTACTG
TACTTGTGCATATTGATAAGCCACGTTTGGCTAATGCCGC
ATTGTGTGTTATGAGGTCCTACACTGTACTGAGATTTATT
TTGTGCAAGGTCAACTCGGTTTCGTCTCGACTTGAAGGTT
GTACCGGCTCCAGCGCACACATTGAAGCCATAATTGCTAC
TATGTAGCAAAGCTTTGGCAACGTTCTTGCTGTATTTCTT
TTTCTAGTGTCTCAGGTTTGTAGGTTGAGATTATTTTGAA
ACTACTCTGTACATTTTTGGGACATGCCAACAACGCGTTG
GAACATATCTAGATACAATCAACTGTTTTATATCTACATG
TAAAGTAAATATTCTAAGTATTTATAATTCATGGCAGTAA
AAAAAGAACAAATGCTAAGTTGTTGTGTGAGTTCTGCTGT
CTGGCCTTACAATTCGAGTTTATTTGTATAGAGCTTTTCT
CAATAATCATTGTTTCAAAGCAGATATACGAGGTGCACAT
TACTGCATTATTGCAATCAAATACAAAAAAAGTTAAGGTT
ATTAGTTACCATCATTTCATTATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations