Transcript

si:ch73-170l17.2-001

ID
ZDB-TSCRIPT-131113-3000
Name
si:ch73-170l17.2-001
Previous Names
  • ch73-170l17.2-001
Transcript Type
antisense
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000059325 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059325|OTTDARG00000041135|ZDB-GENE-131127-189 si:ch73-170l17.2|no_translation CH73-170L17.2-001 LG_ CU179756.8 Danio rerio antisense NOVEL, 2094 bp
TACAAAGTTGTGGAATCCAACTTTTTTTTTGGTGGGGGGT
GGGACCAGAGCGGAGTATGAACAACAGTTTATTGAACAGG
ATGGCAGGTAAATAACTGAATATGTCTATTGCTGGACACG
TGTAGAAGGGACCGGAAGAAGAAATGAAGCTAGGTACTGA
GGGACCGGGGAGCAAACAACCAGATGAGACCAGGAGGGAA
CCACAATAGGAGGAAGAGACACAGACACTAAAGATCATAG
AAAACCAAGACTGAGCTCGACGGATCTCCGTGGCGCTGAT
CTCATTGTGAACCCACTCCCGAACCAGGAAAATGCTTGGC
CGGTGCTTGGACAACAAATCAGACTCATGTATAGCACGAT
CAGGCTGAAGGCTGCCACGGCTCACGCAGACCAGTCCAAA
TCGGCCCACAACCTCCTCGATGTGCTCATCCGTCCACAGA
CCAGGCACTTTAAAGGAGTCCATGAAATCAGCTCCACACA
ACAGCTTCAACTGAGGAACATCTGAAGAAAAAAAACAGTA
AGATTACTAGTTGTGTATAAGGTAACAGGAGTCATTAACC
CTTGAGCGCTGTTGGGAATGTTTTCATCCACCTTGTGGGG
ATGTTGAGTCTTAATTTTGACACATATTTTGGGAAAATGA
TTAGAAATTTTTAAAAATGTCAACAATACACTCTGGGTAA
ATTTACCACCCTTTATGTTAACAGAAAAAAAACACACATT
TTACCTCTTCCCAACAGGGAAAACCACCAACAATCAAGAA
TACATGATTATTTGGTGTCATGACTTTGCAATCAAAAAAG
TGTAAGTATAATGGAAGTCAAAGGGGCCAAAACAGCCACC
AACATAAAGAAAGGGTAGTCAATTTGCCCATATTGTTGAG
TTTTTGAAAATTTCAAAGCATTTCCCCATAGTATGAGTCA
AAATACGGGTCACCAAAAATCATTGCATTTTGCTGAAATA
CATAACAAAAGGGAACAAAACTTGAATGGTACACAAGGGT
TAAATTAAAGTTAACAGTTAACAATGCTTTTTTACTTTTG
GAATGTTAACCCTTGTATTGTTCAAACTTACTACCTATTC
GTTATGCTTTCTTGAGAGTTAGCGATTTTCTTAGCTGGGA
AGAGGTAAATGATCATTAGTTTGCACCATTTGCCCTTTAG
ATTTAGCCCTTTTTAAGCCAGTGCAAAAAAGTTTCTGGTT
CTTATTTGGAGCTCTATGAAGTATAACAGCAAATTATAGT
GTACATGCATAAATACACTCACTAAATTACTCTGTTCTGT
GAGATGAGGTGCTTATTTTAATTTTTTCAGACATATCAAG
GTACTGTAAGTGTGCAAAGGTCTCTCTCAGATTGCGATCA
AAAATGTGATTATGATGGAAGTCAATGGAGCAAAAACAGA
CCCTAACATAACGAATGGGTTGTAAATTTGCACATAGAGT
AATGTTGAGTTGTTGTTTTTTTTATTCAAAACATTTTCCC
AAAATGTATGTCAAAATAAGGAGTCACTAAAAATCTTTCC
ATTTGCTGAAACACAGAGAAAGTTGTGGCTTAATTAAGAC
TCAAAATCACATCACCCCAAAGTGGATGGAAACATCCCCA
ACAGCACACAAAGGTTATTCATTGTAAAGATGTGTGTATG
TGTGCTTTAAAACATGAGACCTGACTTTTTTTTCTGTAAT
ATAAAGGCTACAACATGCTAACTAATCTATAGTATGTTGT
TTTGCCTGTTTATAACATCTTCTGATGTTTAAAGCCTGTT
TAGTTAAGCAATGCTGTTCTTATGCTGTATTTATTTATTA
TAATTATCAGTCATTGTCAGATGATTTCAGTCATAGCTAT
GCAAAGATTTTATTTCAACAACAGTTTCGTTTGTTATTAA
ACTTTCTTGTTATTAGCTTAAATCTGTATTTAACCTCAGA
AAATCTTCACGTAAAAAAGAGGCGCTTAAGTCAGAATTTG
TGGTGACTGTGTTTTAAAATTAAATTATTATGATCCTTAT
TTATACCTGGTTTAAACATTTGGAAATTATATACAGTTTT
ATTTTTTATTTTTAAAGGATGTTTAGAAGTAATAAAATGC
AATCAGTTAGATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations