Transcript

zgc:77118-202

ID
ZDB-TSCRIPT-131113-294
Name
zgc:77118-202
Previous Names
  • ch211-272b8.3-001
  • zgc:55413-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051113 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051113|OTTDARG00000035867|ZDB-GENE-040426-2909 zgc:55413|OTTDARP00000040176 CH211-272B8.3-001 LG_ CR387932.20 Danio rerio protein_coding KNOWN, 2264 bp
ACGCTCCAAACAATTTACCAGCTGTTTTATCGTGGAGCGT
CCTGCTAAGATTATAAGCAGTTGTGGCGATGGCTGATGGC
TGCAGACCATGTGTTTTTATTTTGGTTGTTTTACTGCTGC
TGCCCTCAGCCATCATGGCGTACAGACCAGTGATTATTAT
TCATGGGCTATTTGGTGGACCTAAAGAGTTGACACCCTTT
GTGAACTTCATTAAAGAGTCTCATCCAGGTACGAGTGTGA
CTGCACCATCTCTGTATGAATACGCAGCCAGTGTGAAGCC
AATGTGGGTACAGGTGGAAGGCTTTAAAAAGGTCATTCAA
CCCATCATGGAGAGCGCTGAAGATGGTGTCCATCTCATCT
GCTATTCGCAAGGTGGTTTGATATGTCGAGGAGTTCTTGC
TACTCTTCCTCAACACAATGCTCACTCTGTGATATTCCTG
TCTTCACCACTAGCTGGCCAGTATGGAGTTACAAGGGCCA
TCAGCGGTGTGTTCCCTAAACTGCCCAAGTCCTCACTGCA
CAATGTTTGTTATACTGAACTTGGACAAAAAACATCCTTC
TGCAGCTACTGGAATGATCCACATCATAGAGAGAAATACT
TGAATTCCAGTGTCTTTCTGGCCCCGCTGAATGGAGAAGT
TGAACATGTCAACTCAACAGAGTGGCGAAACAATTTTCTG
CGCATAAAAACCATGGTGTTGATTGGCGGACCAAATGATG
GTGTTATCTTACCGTGGCAATCAAGGTCTCCACAAAAGCT
CCCAAAATTAACCCGAGCCTCGTTCACACATTTAACCTGC
ATTTCTTAATTCCAGCCCAGCACAATTTCCCCCCTCCCAC
ATCAGTTTTTAATTGCAATTCTACAAGTTCCCTGCAAAGC
AAACTCCACAGGAAAGTCCACCATGAATTTGAATGGAGTG
TTTTATTCAAATGGCATTTAGTGGATGAGCTTTTGCCTCT
CAAGGGTTGCTAACTGTTGGCTGTAAAAATCTAAAACTGT
ATTTTAAGTGCAATAATTAAATGACACTAACAGCAATCGT
TGCATTTGAAATTGTCCTGACAATCAGCTAAGGTTTGCCA
CTCGACTGTATTGTGTGCTCCTAAGGCACAGGTGTCCACT
CCAGTTTTTGGAGGGCCACAGCTCTGCACAATTAGTTTGA
TCAGGTGTGTTTAACTAGGGTTGGAACTAAACTGAGTCCC
TCAGTTTTGTTTAAAACCTTCCAAGTAAAGCTGCAGTCAC
ACTACAGTTTGAGCTTGCGAAATTCTGTTGTACAACGCTG
CAAAAAAAGGGTGGAATTAAACAAGATGATCAGACATTTG
AAAAAGCGAGCGATTTGGTTCATTTCTGTCCAGAGAGGTC
ATGTTTTGATCTTTGATTGGTCTTGCGCGGTCAAATGATG
TGCTTTCGCTGGTCAGATCACCAAGCTTGAACTTTGCAAC
GCAGTGAACTGTGAAACTTGACTTGCGACCTTGCGTTTCC
GGAATGATGCATTCATGTGCGTGTGAATGGAAGTATATGG
GGAGAAAAGTTCAGTGTGACCGCAACTTAAGTGCGTTGAA
GCAGGGTTGGAACTAAACTGCAGAGCTGTGACTCTCCAGG
AACTGGATTTGACACCTGTGTCCTAAAGGGTTTGTGTTTG
GCAGACTGTAATTCATGTGAAAAATATTTATGGATTGTGT
TTTTTTTTGGGGGGGGGTCATCTGTAGCTTTCAGGTTCTG
AACACCTTTTTCTCTCCTCACAGTATGTTCGGGTCTTATG
ACCGTAATGGAAAGGTGATTGATATGGAAAATCAGGATGT
GAGTGAATGCATTAACCCCCCCTTAATTTTTGCTGGTGCT
GTTTGGTTATGCTAACCGTTTTTCACCTTCTCCCCAGTTT
TATGTAAGGGATACCTTTGGCCTGAAAACACTGAAATCCC
AAGGTGTCTTGTGGAAGTGTATTATTCCTCGTGTTAAGCA
CAATTCCTGGCCTTCAGACCCCAGGGTCTTCCAGAACTGC
GTAGAAAAGTGGCTCACGTAATCACAATCCTGTACGCCAA
TTCTCAAACTCCAATTCCTGGAGGGCCGCAGCTCTGCACG
GTTTAGCTCCAACCATCCCCAACCCACTTCTGCTTTTCAG
ATCAGCTGTTTTATTAGGGTTGGAGCTGTGCCGAGCTGAC
ACCCTCCTGGAATTAAGTTTAAGACTTGCTGTCTGCTGCA
AGTAATAATTTGTCAAGATTTGTACTTCTTTTTAACACAA
ATAAATAAACTATATTTTGTTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations