Transcript

aasdhppt-201

ID
ZDB-TSCRIPT-131113-2898
Name
aasdhppt-201
Previous Names
  • aasdhppt-001
  • zfos-1477g3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000057938 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057938|OTTDARG00000040378|ZDB-GENE-050913-36 aasdhppt|OTTDARP00000045373 ZFOS-1477G3.1-001 LG_ CU694319.10 Danio rerio protein_coding NOVEL, 1203 bp
CTCTGTATGTGTGTGTGGTTAAAAGAAAAACACATGTGCA
GCTGCTGGCGTAACCAGAGAAGCAAAACACATTATAAATA
CTGCATGAGACATAATGTTAATAATTAATAATAACGACTA
CTTAATATCATAATGGCATATTATAATGTATTAACAACTA
TTAGTCGCAGTGTTTTAAGAGTTTAGAAATAGTTGTCATT
GGGAGTTGTGTGTTTTTTGGGGGATGGACGGGGTCCGGTG
GGCGTTCCGCTGCGGTTCGTGGGTCCCGAGCCGTTCCGAC
TGGACCCTCGCGGCTCGGTGTGTCCAGCAGGAGGAAAAAC
AGCGAATCGGACAATTCGTGTTCGCTAAAGATGCCAAATC
CGCCATGGCTGGACGTCTGCTCATCAGAAAGCTGGTTTGT
GAGAAGATGGGTTTTGCATGGGACGGGTTTCGACTGGAAC
GAACAGAACGGGGCAAACCGTACCTGCCACAGACCTCATC
CGCACCCAGCTGGAGCTTCAACGTGTCCCATCAGGGAGAT
TACGCCGTTCTGGCAGCAGAAGCAGGTCGTCAGGTGGGCA
TAGACGTGATGAAGACCAGCAGACCAGGCAGCAGCTCCGT
GCAGGAGTTTTTCCGCATCATGAATCGTCAGTTTACAGAT
CTGGAGTGGACGAACATCCGGACGGCGGGATCAGACTGGG
ACCAACTGCACATGTTTTATAGACACTGGGCATTAAAGGA
GAGCTTCATTAAAGCGATTGGCACAGGATTGGGATTTGAC
CTGCAGAGGGCGGAGTTTCACATCTCACCCAATCAGATGC
GAGAGGGCCAGGTGTACTGGCAGACACGGATGTACCTGGA
CCGTGAAGAAGAGGAGGACTGGACATTTGAGGAGAGTTTA
TTGGACAAAGACCATCACGTCGCTGTGGCGCTGGGAAAAC
CAGATATCAGCATGTCTAAGAAGGATGGTGGAAGTTCTTG
TGAAGCTCCGCCAGCTGCATTTACAGCATTGAGTTTCAGT
GATCTGGTGTCACAAGCCACGCCCCTACTAGATGAAGACC
CCGCCTACTGGGAGGAGTTTCAGAAGAAAAAGGATGCACC
TTCAAGGCAAAGTGACCAGGAATGACTCTTGGATGCAAAT
TTGTAAATAATAATTTTCTTTTGTGGTCATTTGGGATCTG
TACTCTCTTTTGAATAATAAAAAAGTGTACATTTTGTATC
ATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations