header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2872
Transcript Name: si:dkey-42l23.2-201
Previous Names: dkey-42l23.2-001, si:dkey-42l23.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057773 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057773|OTTDARG00000040250|ZDB-GENE-131121-582 si:dkey-42l23.2|OTTDARP00000045265 DKEY-42L23.2-001 LG_ CR848836.10 Danio rerio protein_coding PUTATIVE, 1949 bp
CTTTCATACAAGGGGAAACAGCCAGCAATTGCTCATGTGA
AGACACTGTTGAGAGCTCTGATAACAAACACCCTAGGAAG
GACAGGGGGAAAGGACTGAAAATGGCAAACAATACTATGG
GACTGAACAACACAATGCAGCAGGAGTTAACAGCCACTGA
AATCTTCAATATATGCATCACTACTGTAATCTTTGCAGTG
GGTATCATTGGAAACGCACTTGTTATATACGTGACGGGCT
ACAAAATGAAGACAACTGTCAACTCCATTTGGTTTCTAAA
CCTGGCGATCGCAGACTTCATCTTCATCTTATTTTTAATC
CTGACCATATTTACCTTGATTAACAAGAGGGTTTGGTACT
TTGGTGACTTCATGTGCAAGTTAGCCTCCTTTGTGTCAGT
GCTGAACATGTTTGCCAGCATTTTCTTGCTCACCGCTATC
AGCCTGGACCGGTGTATGTCCACCTGGTGGATTGTTTGGG
CTCAAAATAAGCGAACTCTTTTCAAAGGCAGGATCATCTG
TGCATTTGTGTGGGTTTTATCCATCTGCTGCAGCATACCG
TTTGTCATCTGCCGTTCAGGAGAGAATAAAACATGCAAAT
ACAATCCTGGTACCAATATAAACTTTCTGTTCACATACAG
GTTTATTGTGGGCTTTCTCATCCCCTTTCTAGTCATTGCA
TCTTCATACATTGCTATAGGAGTGAGGGCCAAACGTCTTA
AAAGAGGGAAGAAACTTAAGCCTTTCCGTGTCATTTTATC
AGTAATCCTGGCCTTTTTCATATGTTGGCTTCCCTTTCAT
CTTCAGCAGCTAATTACTGCAATGACAAAGGGGAAAGATG
AATGGAGTGGCATTCGAAAAGTATTATATAATATAGGACC
CTTTGTTGGCAGTCTGGCTTACTTCAACAGCTGTCTGAAC
CCCATCCTCTATGTGTTCATGTGCGAGGAGTTTAAAAAGA
AGCTCAAACAGTCTCTGCTGCTGGTGCTGGAGACAGCGTT
TGCTGAAGATCTGCCTTTCCGAACACGTCAGTCCACCTGC
TCAGCCTTCTCAGAATCACAAGGTCTCCAACAGCCAAACG
ACGCAACCTTCTCATCTTCTGCTAGCAGCCAGGACAACAA
AACAACTCTATAGAAAAGCAGCTTTCAATAGTCATTCCAA
GCACAAAAACAAACTCCCCACAAAACCCATAAGGGATTCC
ATGTTTTCATAAGAAACCCCCATAAACTGCAGGCTTCCTT
GATATTGCAAACAACCTAACAGATACTATGGGAGAACAGA
AGACTAGGCCTCCCTGAAAGCCATATTTGATCTAAAGACA
ATCTAAGACATATTTCTGATTGCTCCTGGTGATTTCATTC
AGCCATTTGGTCCGCTTTAGACAACAATACCAAAGGTTTT
GAGAACAACATGAAGGATGCCAGATCATGACATGAAAAGG
ATGTGAAGGATGCCAGATTTGTGTAAGAAACCCCTCTAAA
TGTGCTTATTTTTCCATCATCGCTTTAGGACTGAAAAACA
ACCAATGCCTCAATTCTGCAGGACAACTGAGGACTTGGCA
ACACTGAAAGCCATATTTGATTAAAAAATCTATGGTCCTG
TTTATACATTTTGAGATGTGTTTTGGTGGATTGAATCACA
AGAGAGACACATTCACCTAGTGAATAATCACTCTTGTCCA
ATTTTGAGCACATTACCAAACTTTGAGGGTATTAACAAAC
TCTTCACTGTGCTGCCTTGATGCCATTGGGGTTGCCAGGT
AGGTTGTAACAAACAACCCACAAACTGCAAGTCTGTCTTT
GTCTGCAAGTCGGTTTAGTTCATTAGACTGAACAAATTAC
CTGCTGCAACTGTAGATCATCTCTAATGGAGGACTGAGGA
CTTGGCAACACTGAGTATGTTTACATAGACACCATTAATC
CAATTTTTATATGATTAAGACAATACCCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-42l23.2-201 Contained in:
[BAC] DKEY-42L23 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057773 (1),  Ensembl_Trans:ENSDART00000156874 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH453614 (1) 836 bp
CITATIONS (2)