Transcript

zgc:77118-204

ID
ZDB-TSCRIPT-131113-2850
Name
zgc:77118-204
Previous Names
  • ch73-95l15.6-001
  • zgc:77118-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057679 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057679|OTTDARG00000040191|ZDB-GENE-040426-2211 zgc:77118|OTTDARP00000045192 CH73-95L15.6-001 LG_ CR387932.20 Danio rerio protein_coding NOVEL, 1162 bp
GTTTTATCGTGGAGCGTCCTGCTAAGATTATAAGCAGTTG
TGGCGATGGCTGATGGCTGCAGACCATGTGTTTTTATTTT
GGTTGTTTTACTGCTGCTGCCCTCAGCCATCATGGCGTAC
AGGCCAGTGCTTATTGTTCACGGGCTGTTTGGTGGACCTG
TACAGATGACACCGTTGGTGAACTTAATTAAAGAGTCTCA
TCCAGGTACGAGTGTGACTGCAGTATCTCTGTATGACTAC
ACGGACAGTGTGAAGCCAATGTGGGATCAGGTGGAAGGCT
TTAAAAAGGTTCTCCAACCCATCATTGAGAGTACTGGAGA
TGGTGTCCATCTTATCTGCTACTCGCAAGGTGGTTTGATA
TGTCGAGGAGTTCTTGCTACTCTTCCTCAACACAATGCTC
ACTCTGTGATATTCCTGTCTTCACCGCTAGCTGGCCAGTA
TGGAGTTACAAGGGCCATCAGCGGTGTGTTCCCTAAACTG
CCTAAGTCCTCACTGCACAATGTTTGTTATACTGAACTTG
GACAAAAAACCTCCTTCTGCAGCTACTGGAATGATCCACA
TCATAGAGAGAAATACTTGAATTCCAGTGTCTTTCTGGCC
CCGCTGAATGGAGAAGTTGAACATGTCAACTCAACAGAGT
GGCGAAACAATTTTCTGCGCATAAAAACCATGGTGTTGAT
TGGCGGACCAAATGATGGTGTTATCTTACCGTGGCAATCA
AGTATGTTCGGGTCTTTTGACAGTGATGGAAAGGTGATTG
ATATGGAAAATCAGGATTTTTATGTAAGGGATACTTTTGG
CCTGAAAACACTGAAATCCCAAAGTGCCGTGTGGAAGTGT
ATCGTTCCTGGTGTTAAACACAATTTCTGGCCCTCAGACC
CCAGGGTCTTCCAGAACTGCATAGAAAAGTGGCTCACGTA
ATCACAATCCTGTACGTCAATTCTCAAACTCAATTCCTGG
AGGGCCGCAGCTCTGCAAGGTTTAGCTCCAACCATCCCCA
ACCCACTTCTGCTTTTCAGATCAGCTGTTTTATTAGGGTT
GGAGCTGTGCCGAGCTGACACCCTCCAGGAATTAAGACTT
GCTGTATGCTTGAAGTAATGTGTCTAGATTTGTACTCCTT
TTTAACACAAATAAATAAACTATATTTTTTGTTATTTGAG
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations