Transcript

dclk1b-201

ID
ZDB-TSCRIPT-131113-2843
Name
dclk1b-201
Previous Names
  • dclk1b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057652 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057652|OTTDARG00000040172|ZDB-GENE-080516-7 dclk1b|OTTDARP00000045171 dckl1b-002 LG_none CR854883.9,BX530409.7 Danio rerio protein_coding KNOWN, 8316 bp
CCCCCTGCATCAACCTGACTTTGAATACAATAGTGGGCGT
GACTCTTGTCAACATCAAAGTTCATGTCATACTTTTATTT
GAGAGTTTAAACGAATATATATTCGTCCCACTGGAGCGTC
TCTTGCCGGACTTTAAGCGGCGCAGAATAGCCTCCTCCCC
TCCCGCGTGGACCCGCATTTCAACAGTCTAGGTGTCTAGG
TAGGCAGCTCTCTAGATTTTGAGACACAGCCCTACTCGCT
CGTTTTCATTCATAGAGGGATTTCTTTTCTCCATGCAGGA
ATACGACAAAGGCTGCCTGCATTAAATAAGAGCGAAAGGG
GCAGACAGACACCGGCTGCAACCCATCCGCCCCATCCAGC
AGAGCAGAGCACATGATTCAATCCTCCTGCTCTTAAAAAC
CAGCAGCAGCCTCCACTGGAAGAGATGACAAGCCATTAGA
TGTGCGCTTTCTCATCGACCGTGCTCATCGGATACACGCG
CACAAACATACAACAGCCCCGGGTGTCGACATGGAGCTGG
AGCATTTTGACGAACGGGACAAAGCACAAAGGTACAGCCG
TGCGGGTTCACGTGCCAATGGCCTGCCTAGCCCGACACAC
AGCGCGCACTGCAGCCTGTACCGAACCCGGACCCTACAGG
CTCTGAGCTCCGAGAAGAAAGCCAAGAAGGTGCGCTTCTA
CCGCAATGGGGACCGCTATTTTAAAGGGATTGTGTACGCC
ATCTCCAACGACAGATTCAGGTCTTTCGACGCCCTGCTCG
CAGACCTCACCCGCTCCTTGTCTGATAACGTTAATCTGCC
GCAGGGAGTTCGGACCATTTACGCCATTGACGGCTCGAGG
ATCACCAGCATGGAGCAGCTGGTGGAAGGGGAGAGCTATG
TGTGTGGATCAATTGAGCCTTACAAGATGCAGGAATATAC
TAAAAACGTCAACCCTAACTGGTCGGTCAACATGAGAACC
ACTGCCGGAGCAAAACCGCCCACCTCTCTGGCCAGTGCCA
AGGGCGGGTCTATAGAAACCAAGGATAACAGGGATTTCAT
CCGACCCAAACTGGTGACCATAATCCGTAGCGGGGTAAAG
CCTCGGAAAGCCATCCGAATCCTTCTCAACAAGAAGACGG
CCCATTCCTTTGAGCAGGTTCTCACAGACATCACAGATGC
CATCAAGCTGGACACTGGAGCGGTCAAGAGGCTTTATACG
GTAGACGGTAAAATGGTGACCTGCCTTCAGGACTTCTTTG
GAGAAGATGATATATTTATTGCCTGCGGCCCAGAGAAGTT
CCGCTATCAGGATGACTTCCTGCTGGATGAGAGTGAGTGC
AGAGTGGTGAAATCGCAGTCCTACGGCCGTATCTCTTCAA
TGCAGGGCCGCAGTTCTCCTCGCAGTGGTGGACCATCAAG
AAGGAGCAAATCCCCTGGTTCCAGCAGCTCAGCTAATGGA
ACAGCAGGCAGTCAGCTGTCCACGCCACGCTCAGGAAAAT
CTCCCAGTCCATCTCCAACCAGTCCAGCCAGTCTGAGAAG
AAGAAGGGGCTCTCAGCACAGTGGCTCATCTTTGTCTCTG
GCCTCCACCAAAGTGTGCAGCTCCATGGATGAGGGCGACG
GGCCAGGCAGTGAAGCTGAGCTGACGGAGGATTGTCCTCA
GGTTCCTGCTTCCATTGCTGAGAGGTACAAGGTGGGACGG
ATGATCGGTGACGGGAACTTTGCCGTGGTACGCGAGTGTG
TGGAGAGATCCAGCGGCCGAGAGTATGCTCTAAAGATCAT
CAACAAAAGCAAATGCAGAGGGAAGGAACACATGATCCAG
AATGAGGTGTCGATTCTTCGGAAAGTGAAGCATCCTAATA
TTGTTCTGCTGATTGAAGAAATGGACACATACAGTGAGCT
CTACATGGTCATGGAGTTGGTCAAGGGTGGTGATCTCTTT
GATGCCATCACCTCCTCCAACAAATACACGGAGCGGGATG
CCAGTGGGATGCTGTATAACCTGGTCAGCGCTATCAAATA
TCTACACAGCCTTAACATTGTTCACCGGGACATCAAACCT
GAGAATCTCCTGGTCTTTGAGCACCAGGATGGGAGCAAGT
CTTTGAAACTGGGGGATTTTGGCTTGGCAACAATTGTGGA
CGGTCCGCTTTACACTATCTGTGGCACCCCAACCTATGTA
GCTCCAGAGATCATTGCAGAGACTGGGTATGGCTTGAAGG
TTGATATCTGGGCGGCAGGGGTTATAACATATATACTGCT
TTGTGGCTTCCCTCCGTTTCGTGGGAGCACAGATGACCAG
GAGGCTCTTTTTGACCAGATTCAGATGGGACAGCTGGACT
TCCCTGCTCAGTATTGGGACAATGTGTCTGACTCTGCAAA
GGCTCTTATTACCGGCATGCTGCAGGTAGAGGTGGAGCAG
AGATACACAGCTCTACAGGTGCTGGACCATCCCTGGGTCA
ATGATGACAGGCTGTGTGAGAATGAGCACCAGTTGTCTGT
GGCTGGCAAGATTAAGAAACATTTCAACATGAGCCTAAAG
CCCAACAACACCACCGCAGGAGCCACTATCATAGCAAGCA
CCCCTCTTGATAAGGAGAGGCAGGTTTTCAGACGAAGACG
CCACCAGGATGTGAAAGCCTCCACAGGCCGCGGCACTCAG
AGCTCCTTCTCCACCGGCCCGACTCTCTCCCCGGCAGACT
TCACCTCAGAGTCCGAGGACATCTCACCAAGCTCCGCCGA
CACCGTTCGCTCGCCCACATCACCGTTTTAAAGCCACAAT
TGCTCCTGACTGCAATTCTTGGGAAAATGTCTAGAAATGA
AAGGTAACTAAACTGACTCGAGAATAGCGAAAACTAAAGG
CTGAGTCGATTTTTTTCTCTGTTTTTATTCTGTGACGGTA
GCACATCTACAGAGGTGTACGAAATAATCTCACACTCTAA
GCAGTTTTCAGACTTTTTGAACGTTTTCTCCTCATCATAA
CTACATGTTTGGTGCTACTGTATACAATATGAGGTTTTGT
GTTAAGACCATGTTCAAATCTGCCTTTCTACTGTAGTACT
GTAGTAAACAGAGTCTTTTCCGCCCTCTAGTGTTTGACAG
GGAGAAATGCAGCCACACATACAGCTATGGAACACAAGCA
GAACACTTGGAAATACTCAGTTTCTCTGGATTTATTTATT
AGATAGATTGAGTAAAATGTTAATTTTGATTTATTATATA
AAAGTGTGATTTTTCATCCAAATTTCAAATAAAAATGTGT
TCTTTTAGAGCAACCCCCCTAACCCCCCCAATAAATACAT
AAATAAATAAATAAATAAAATAAAAAATAAAAATGACAAT
TGGTCAGATTAATAAATAAAATATTTAAATGACAATTAGT
CAGATAAATAAATAAATAAATAAATAAACAAAAAAATGTA
TTAATTAAAATTAATTAATTAATTAATACATGACAATTGG
TCAGATAAACCTCCCCCCAAAATAAAGTAAATAAACAAAT
AGAAAATAAAAATGACAATTGGTCAGATAAATAAATAAAT
GACAAATGGTCAGATAAATAAATAATAAACAAATAAATAA
ATAAATGACAAATTGGTCAGATAAATAAATAAATTAATTA
ATTAATTTAAAAAATGACAATTGGTCAGATTTCAGTGTGG
AGTTTGCATGTTATCCCTGTGGTGCTCTGGTTTCCCCCAC
AGTCCAAAGACATGCGTTATAGGTGAATGGAATAAACTAA
ATTGGCCGTGGTGTATGTGTGTGAATGAGTGTGTATAGAT
GTTTCCCCATACTGGATTGCAGCCTGAAGAGCATCCGCTG
TGTAAAATGCTGGATAAGTTGGCGGTTCATTCCGCCCTGT
TGAACCCTAATGATTGAAGGGACTAAGCTGAAGGGAATTG
AATGAATGCCAATGTTTTAACTTCAGAAAAGTTAAGAATT
CAATATCTCCTTTCACAACAAATAAAAGCCTTTTTTATTC
TGACCAGTTCTCCTAATTTATTTATTTATAAATCTTTTCA
AAGGTTACCTTTATATAAATAATAATAAAAGCTTTACTTA
AACCCACATCTAATAAATCCAGAAAAACTAAACATTTTGA
AGTGGTCTTTTAATTTCCCCCATAGCTGTGTGTTTAATCC
CCATTATAAACCTGTTTAGCATCTCTTCTCTCTTACAGTG
AATCTTGTATGTGGGTTTTTACCTTTTTGTATGAACTTTG
TATATTCAAACAACTTTCGTTTTGTACATTCCTTTCGACC
TGAGGACTATATTTGCATATTTCAGCATTTCCTTTGGTTT
CTGTGTTAGACATTAGAATGTTCTTTATAAAATGTGTGAA
CACTAGTTGAAGCTTTTTTAGCTGTGTGTGTGTGTGTGTG
TGTCTGTAGGAATTCTTGTTTGATAATTGATGTTATGGGT
GCGGATTTAACACGTGTGATGTTGAGTGACTGGAAATTTG
TCAGTCGACGCAGCTGCTATAATCTCTTCGTCAATGAGTT
TGGTTTTGTCGACTCATCATGAAGGCAAATAGATCGTACA
GCTGCTTTCTGGAATTTTCTGCTGATGAGAAAACAGAATG
TAGAGTGGTGGAATTGTTTATTTATAAAGTAATAAAGAGG
ATCCAGCAGGCAACTTGATGTCAAAATCATGACATCTATT
TGACATCCACACGTTGGTCCTTTTGACCAGCAAAATAATT
GTCACAAAGATGGCAGGGTGCTTCAGTGGTTAGGACTGTC
GTCTCACAGCAAGGTTGCTGGTTGGTGTCACTGCTGGGCT
AGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCCCTGCG
TTCCCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCATA
GTACAAAGACATGCGCTGTAGGTAAATTGAATAAACTAAA
TTGGCCGTTGTATATAAATGTGTGTATGGATGTCTCCCAG
TACTGGGTTGTGGCTGGAAGGACATCCACTGCGTAAAGCA
TATACTGGAATAGTTGGCAGTTCATTCCACTGTGTAGACC
TCTGAAATAGAGATTAAACTGAAGGAAAATGAATGAATGA
ATAAATGAATGATGTCACAAGAAGGATTATATTATAAGAA
AAGTTTTATTCTTTGAAAACTTCTGTTCCAAATTACAAAT
GTACACTGGATTTATCATTTATTCATTTATTTTCTTGTCG
GCTTAGTCCCTTTATTAATCCGGGGTTGCCAAAGCAGAAT
GAACCGCCAACTTATCCAGCACGTTTTTACGCAGCGGATG
CCCTTCCAGCCGCAACTGATCTCTGGGAAACATCCACACA
CACACACACACACACACACGCACACGCACACACACGGAGC
ACCCGGAGGAAACCCACACGAAGGCAGGGAGAACATGCAA
ACTCCACACAGAAACGCCAACTGAGCCAAGGTTCGAACCA
GCGACCTTCTTGCTGTGTGGCGACAACACTACCTACTGCG
CCACTGCTTTGCCCTTACACTGGATTTAGTATTCTTGTAA
TGCGTGTAAACTACTTTGTGTCAAAATTACATCAAATTTA
CATCAATAAACATGTCAAAAATCGATTTTTGGCCTGTTTT
TGACACCAGTGTTAGATGCCGATTTGATGTTGTTTTGACA
TTTAAGCAGAAATTTGACATCAAATTGATTTGCATTTATT
AAATGCATTTTGGACATGTGTTTGATGTCGTTTTGATATC
AAGGTGCCCGCTGAGGAGCTTAAAGGGATAATTCACCAAA
TTCAAAAGAAAAAAGGGAAATAATTGCGATTTCATTTCAG
GCCATTTGACTTTTGTTCTTCAGTAAAACAGTAAATAAAT
CAAGATTTTTGGACAATCAGTGCACAGTTCAAAAAAATAT
CCATAAATTAACAATTTCCATATTTTGTTTGCATGTATTC
CATAACTCATGTTTGCATTGTGGGACCTTGATCATTCCTC
CGACACTTTTGATGCTAAAGTTTGAAAAAAGTGACTTTTA
CTGACAATTTTTGATGTGACATTTGATGCGATACAAAGCC
TGGTAATAATCTGGCAGTACTTTTCCTGTTATTTTACATC
AAACCACTAAAACTTTAGTTATAGCCACTTTGATAAAGCA
CGCAGTTGAATTTTCATCATCAAAAGTTGACAGAGAAGAG
ATTAATGTCCCATAATCCAAATCACAACCGTAAATAAACT
GAAAAAAAAAACCTGCAATATGGAACCTCTTAATTAACAG
ATTATTTGTTACAGTAAGGCTTTGTAAATTAAAGGTAATA
CTAATAATGCTCTAAAAAAGATCATTTTTTGACCATTTTG
CTTCAGTGAAATCAGTAAAATCTCACTGTATCATCAGGAG
TAGTTATTTATTTAGTTTTGCTAGTATATGTTTTATTTAC
TCTGTATGAATCACTAAAGATCAGAAAGATAACAAAAAAA
AAGTAAATCAACTTACATTTTTTTAATGAAGGAAAAAGTC
ACCTCAGTAAATTATTGGCTGATTTATACTTCTGCTTCGA
GTGATTGCCATGATTCACGGTGCCTGCCGTAGTCATGCAT
TTATACTTCTGCATGCCGTTTATGTTTCTCTGCCCACACT
TGTCACCGATACCAAGCCAACCAATCACAGAATTTGCGCT
AGGCGTCATTGAGATGTGGTTGCATTTTTTGAGAGGTGCT
TGTCTGCGTCAGCCATAGCAAGGGCTATGCAACCACGTGA
AGATTTCTCTAGATCATATGCGTGCACTTGATGCAGAAGT
ATAAAGGCTGATTTATACTTCTGCATCAAGTGATCACCGT
GACTCATGGCGCCTGCTTTGCAAGTTGCTGTGAATTTATA
CTTCTGCGTGCATTTTGTGTTGCTCTGCAATAACACTTGC
AAAAACGCTAGCTGGCAGAATGTTGTTATGATTCTGTGTC
AAGTTTCTTCATGGGTATTTAGTTTTTTCTGAACGCTACC
TTAATGTACAAGTTGCTAAAACTCACTCATTCAGAGGCGG
GAACCGGCGTTTGTGCAACAACTTTAATTCTAACATAAAC
ACAAACCAAAAGTTTCCTTCTGGAGCCTGCAGCGAGGACA
TTTTGCCTTTACGAGGCTCAACACTTGTAAACATCAGGCT
CGCGGCTCTCAGCACCGCCCACACTTGTCATTGATAAAAA
GCTGACCAATCACAGAGCTTGTGCTACTTCGTTGCCAAGT
ATGTTTACATTTTTTGAGGTTTCACCCACAGCGAGGGCTA
TGCGACCACACGAAGGCTGCCCTGGACCTCACGCGTGCGC
TTGACGCAGACATATAAATCAGCCTTAACAGCAATTTTTG
TTTTTCATCACCATTAATTTTAGGTGAATTATCTCTTTCG
TGTTAGATAGAGTAGGATTATACGTAAATGTTCTTTTTAA
GTTGAATGTAGTCTAATATTTTCATCCAAATTGTTTGTTT
GCATTCCGCAGTCGAATGACCAAGCAAAGTCGTATGTTTT
ATTGTGAATGTATTCGCTTTTTTGTCACACGATGGCCAAA
TATGATGCCACAGAATTGTTTTTATGTGGCTCAGACAAGA
AAATAGTCACTTTTTAAACCATAAGATTGTAAAACAATTT
CAAATCACAATTTGTAATAACAGAGTTGGCTAGCTAGCAC
AACAAAGTACATTTTCAAAAGCAACCAATCTTTAAAGTGC
AAATAAACACTATAGTAGTTAGTTTCATTAAGGAGCAATT
GATCTCTCCATTTATTACAATTCCTTTATGTGGTTTCTTC
CTAGTTTTCGCCCCTTTATAAAGGGCTGAGTGTGTGCCAG
TCTTTTGCATGTGGTTTGAGTGAGTGATGATCGTTTTAAT
ATCCATTTACTCTACCATCAGTACATCCACAGGTAAGAAC
AGTCATATTTGTTGCTACTCAATATTTAACATTTATTAAA
CAGTTCACTTTAGCCTCCAGCATGTGAAGGCATTGTGAAG
GGGGGAATGAAAAGCACAAAGGGAACAAAAAGTTCTTTAA
GGTATGGCATGTGTTTGCTTTTTTAATAAAAACAATGTAT
CTGCTGTGTTTGCTCGTCAGAATTAGACTAGATCCATGAT
CCTCCTGTTTTTCAATAGGTTGTAGGTCAATTCATTAATA
TTGGGAATATTCTAGCTCATATGCAAATGTCAGTGCGCGG
GCATTGATTACTTGTTGTATATTTGTATAGATGTGTCTCC
ATCGCTTGTTCCTTGTCTCCTATCTAATGTCATCAATGCT
ATCAATGCTCAACTTTTTTTTTCTGAATTAAGAGTCTTTG
CTTCCAAGTAGCATTCAAAACAGTGGTGCATTCAGCAACA
AGCCAAACCTGTGAATAAACAATTTCTCAAGCAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations