ZFIN ID: ZDB-TSCRIPT-131113-2695
Transcript Name: si:ch211-235m3.9p-001
Previous Name: ch211-235m3.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056980 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056980|OTTDARG00000039731|ZDB-GENE-131121-311 si:ch211-235m3.9|no_translation CH211-235M3.9-001 LG_ CR382327.27 Danio rerio unprocessed_pseudogene none, 636 bp
ATGGATATAAAAATCGAGTTTGTTAGCTTTGGACTGGCGA
GCGCCGGCTGGTTTTGCACCATTCTCACAAGATTTCTACC
CATGTGGAACGTAAGCGGGATGGTGGAAAACACCACAACA
ACACTTCCATTGTATTGGGACGGCGTCTGGCTAAACTGGC
AATACCACACGACAGGAAGAATCCATTGTGTCTTCTATCA
GACCCTGCTCTCTCTAACAGAGCATTTTTTCCAGTGGAAA
ATCCTCCTGCTCACATCTATAGCCATGGGATTTATTGCTG
TGGCGGTTTACCCTATAGGCTGGATACGCTATCCTAAGTA
CATACGGATTAAAGCTGCGTCGGGACCATGGTTTATTGCT
AGTGCGCTTCCGTTACTGATTGTGATCTCCTGGACTACGC
ATTTAACCGAATTGAAGAGCGATGACTTGTCATTAACTAG
TGAATTAGGAGCAGCGATCTTCACTGGCTGGATCGGTATG
GTGTTTCTTGTTGTGGGTGGAGGAGTGCTGAGTTTTATCT
GCTGTAAAGCAGTACGAAAGCAACAGGAGGATGGAAGACA
ACCACAAACTTCAGAACCAGGAGTTCAGGATCCACTTAAC
ACCACACAGAGTTCTGCGATTATGCACAGCCCTTGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-235m3.9p-001 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056980 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)