ZFIN ID: ZDB-TSCRIPT-131113-2694
Transcript Name: si:ch211-235m3.6p-001
Previous Name: ch211-235m3.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056977 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056977|OTTDARG00000039728|ZDB-GENE-131121-124 si:ch211-235m3.6|no_translation CH211-235M3.6-001 LG_ CR382327.27 Danio rerio unprocessed_pseudogene none, 652 bp
ATGTCTTTCGGATTGGAGCTCGTGGGGATTATTCTATGTG
TCTTAGGCTGGCTTTTGGCTATTGTGGCCTGTGCTATCCC
GATGTGGAGGGTCACCGCCTTCATCGGCTCCAACATAGTG
ACCGCGCAGATCATCTGGGACGGTTTGTGGATGTCCTGCG
TGGTTCAGAGCACCGGACAGATGCAGTGTAAAGTCTACGA
CTCCATGTTGGCTCTGTCCCAGGACCTCCAGGCGGCTCGA
GCGCTGACCGTCATATCCATCCTTCTGACCGTCCTGGCCG
TCTTAGTGTCCATCGGAGGAGCCAAATGCACAAACTGCAT
CGAGGAAGAGTCATCCAAAGCCAAAGTCATGATCTTCGGA
GGGGTGCTCTTCATTTTGGCTGGTCTCATGCAGCTGATTC
CCGTGTCCTGGTCGGCTAATAGTATCATCAGGGACTTTTA
TAACCCTTTGCTGCCTGATGCTCAGAGGCGAGAGATGGGT
GCCGGGTTATACATTGGATGGGCCGCGGCCGCACTTTTAA
TTATGGGGGGATCCTTGCTTTGTTGCTCCTGCCCTCCTCA
GGAGAAGAAATACAACCCGTCTAGGATGCCGTATCCCGCA
TCTCGCTCTACAGGTGGGGTAGGGTACGACAGAAGAGACT
ACGTGTGAAATA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-235m3.6p-001 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056977 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)