ZFIN ID: ZDB-TSCRIPT-131113-2681
Transcript Name: si:dkey-77f5.8-201
Previous Names: dkey-77f5.8-001, si:dkey-77f5.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056932 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056932|OTTDARG00000039695|ZDB-GENE-131120-149 si:dkey-77f5.8|OTTDARP00000044669 DKEY-77F5.8-001 LG_ BX000999.10 Danio rerio protein_coding PUTATIVE, 1974 bp
ATTTGTGTGGTTTGCATATATTGGCGTATATATTCAGATC
TCTGTGCCTTTGTTTTCAATTGTGACTTTTGGTTTCAATT
TTGAACGGGACTTTTATATTGGAGATCAACTATGACGTCA
CAACGCTGCGCCCCGCTCCTGTATCTGCAAGTCGGCCGAA
AGATTGCTTAAAGATGGCGTTTATTAAAGAGGAGAGTGAA
GACGTGAGGATTGAAGAAACATTCACAGTCAAACATGAAG
AGACTGAAGAAGCTTTCACAGTTAAGCTTGAAGAGATTGA
AGAAGCTTTCAGAGTCAAACATGAAGATCCTGAGGAACAG
ACAGACCCGGTTGTGCTGAAGGAGGAGACTGAAGAGATCG
TTAATCTTGATCAGCAGGAAAACCTGAAAGTTTACCGGTG
GATTCACACTGGAGAGAAACCTCACACTTGCTCTCACTGT
GGAAAGATTTTTGTTCATAAAAGGTCTCTTGATGCCCACA
TGGAAACTCACACTAGAGTGAAGCGTTTTACCTGCCATAC
ATGTGGAGTAAGGTTCAGTCAACGAGGACACTTCACATCC
CACATGTTGACTCACTCCGGAGAGAAACCTTTCGCCTGCC
TTCAGTGTGGAAGGAGTTTTGCTGAAAATAAAAACCTGAG
AGCCCACATGAGGATTCACACCGGAGAGAGACCATTTACC
TGCCATACGTGTGGAAAGAGTTTCACTCAACAGGGACACT
TTGCATCCCACATGTTGACCCACTCCGGACAGAAACCTTT
CGCCTGCCTTCAGTGTGGAAAGAGTTTCAGTGAAAAAAAA
AACTTGAAAGCCCACATGAGGATTCACACCGGAGAGAAGC
CTTTTACCTGTCATACGTGTGGAAAGAGGTTTACTCAACA
AGGACACTTCACATCCCACATGAGGACTCACTCCGGAGAG
AAACCTTTCGTCTGCCATCAGTGTGGAAGGAGTTTCGTGA
GCAAGGAGAACATGAAGGTGCACATGAGGATTCACACCGG
AGAGAAGCCTTTCAGCTGTCAACACTGTGGAAGGCGTTTC
ACTCAGAAAGCAGCTCTTGAAGGCCACCTGACCATTCACA
GCAGAAAGATGCTCTACACCTGCCAAATATGTAGAGTGAA
CTACAAAACTAAACATGGCTTTAGATGTCACATGGACATT
CACACCGATCTGATTGCGCTGAAGGAAGAGTTTGGAGAAA
ACAAGAAGCCTTACACGTGCTCTCATTGCGGAAAGAGTTT
TCATTATAAAGCTTCTGTTAAACGCCATGAAGTGATTCAC
ACTGGAGAGAAGCCTTACGTCTGTCCACAGTGTGGAAAAG
GTTTCACGCAAAAATTTGTGCTTAAAATCCACCAGAGTGT
CCACACTGGAGTAAAGCCCTACTCGTGCACGGAGTGTGGG
AAAGGTTTTACAAGTACAAGCGCTCTGAATTGCCACATGA
GCGTCCACACTGGAGAGAAGCCGTACGCTTGCCCTCAATG
TGGGAAGAGATTTTCACAAAAAAGATCTCTGTTTAACCAC
ATATCGGTTCATATCGGAGAGAAGCCTCACACCTGTAAAA
CAAGTAGAGCGAGCCTGTCAACAAAACAAAATCTTAGACG
TCACTTGATCATTCACACCAATGAGAGGCCGTTTGCTTGT
TCTCACTGTGAAAAGAGCTTCAGACACAACAGGTCTCTTA
CTAGGCACAAGAAGGTTCACTTAGAAATGAAGGATTAAAT
ACTAAGTGAGAATCTACAAGAGAGAGAAACCAATCACCTG
CAAACGAAAAGAGCTTCACAAACGTTATCTATAACCTGAA
CAATCACACTGGTGAGAGGACATTTATTCCCAATCCTTCC
CCTTCTCCAGTTTTTGCATGCTCAGTTGAAGAGTTCAGAG
TGTCCAGATTCTCTTCATCTTGAAGAAGTAATGCCCAATT
CACACAGGGCTTTAGTGTCAATGCTTGACAGAGGGCGTGT
CTGAAGTTGGGGCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-77f5.8-201 Contained in:
[BAC] DKEY-77F5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000056932 (1),  Ensembl_Trans:ENSDART00000157310 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF995937 (1) 756 nt
GenBank:EB949568 (1) 607 nt
CITATIONS (2)