Transcript

si:ch73-144d13.4-201

ID
ZDB-TSCRIPT-131113-2666
Name
si:ch73-144d13.4-201
Previous Names
  • ch73-144d13.4-001
  • si:ch73-144d13.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056887 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056887|OTTDARG00000039654|ZDB-GENE-131120-182 si:ch73-144d13.4|OTTDARP00000044626 CH73-144D13.4-001 LG_ CU469509.8 Danio rerio protein_coding PUTATIVE, 1345 bp
TAACTGACTTGATCCTGACTGTATTCTGGCCCACAGAACA
GCAGATTATTATAAAGATGGCGTTTATTAAAGAGGAGAGT
GAAGACATCAAGATTGAAGAAACATTCACAGTCAAACATG
AAGAGACTGAAGAAGCTTTCAGAGTCAAACATGAAGATCC
TGAGGAACAAACAGATCTGATGCCACTGAAGGAAGAGAGT
GAAGTGATTAATGAAGTGGAAGAGAAACCTCACAATGATC
ATGATTACATTGCTGAAGACGGTTCAAACACTGAAAAGGC
TTTCTCAGAACTAAATCCTGGAAGCACATGTTATCTCATT
TATCAACGACACGGAAGCACTTACAGTCAAAAAGTAAACC
TACCAGGACACATTCAGATTCACCAAGGACAAAAAACATA
CACATGCCAAGAGTGTGGAAAGAGCTTTAATAAAAGAAGA
TATCTTCGAGATCACATGAGAGTTCACACTGGAGAGAAAC
CCTACAAGTGCCCTGAGTGTGGAAAGAGCTTTGGACAAGT
GGGACACTGTAATGTCCACATGAGAATCCACACGGGAGAG
AAACCCTACACCTGCCAAGAGTGTGGAAAGAGTTTTAAAG
AAGCAGGAGACCTCAAGGTTCACACGAGAATCCACACCGG
AGAAAAACCCTACTCTTGTCTTCAGTGTGGGAAGGGTTTT
AATCATACGGGACACCTTAAAGATCATGTGAGAATTCACA
CTGGAGAGAAACCCTACACCTGCCCTCAGTGTGGAAAGAG
TTTTGTTCATGTAGGACAATACAAAGTCCACATGAGAATC
CACTCTGGAGAGAAACCCTACACATGCCCGCTGTGCAAAA
AGAGTTTCATCTATAAACTAAGCCTTTCCAGACATGTTAA
AATCCACAAACAACAGAAACCGTACTCCTGCGAGCAGTGC
GGAGATAGCTTCAGTCAGCACGAACACCTGGAGTTCCACA
TGAAGGTTCACTCTGGAGAGAAAGCCTTCACATGCCCTGA
GTGTGGAGAGGGTTATGATCAAATGCCACACTTTGGAGCC
CATGTGAGAACTCACAGTGGAAAGAAACCCTACAAGTGCC
TTCTGTGTGGAAAGAAGTTCAGTCATGGTGCACACCTTGA
AGTTCACATCACAGTTCACACTGGAGAAAAGCCCTACTCT
TGCTCTAAGTGCGGGAAGAGTTTCACACAGAAAGTAAGCC
TCACCAGACACAATAAATCCCACAAGGAAGAAACGCCTTA
AAGCTGCCATCGTATTGGGGTTTCTAACAAAAGGAGACCT
CGAATTCACTTTAAATGAAAATTTTAAAAATTACAATCAA
AATTAAATAAAAAAATTAAATTATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations