ZFIN ID: ZDB-TSCRIPT-131113-2666
Transcript Name: si:ch73-144d13.4-201
Previous Names: ch73-144d13.4-001, si:ch73-144d13.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056887 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056887|OTTDARG00000039654|ZDB-GENE-131120-182 si:ch73-144d13.4|OTTDARP00000044626 CH73-144D13.4-001 LG_ CU469509.8 Danio rerio protein_coding PUTATIVE, 1345 bp
TAACTGACTTGATCCTGACTGTATTCTGGCCCACAGAACA
GCAGATTATTATAAAGATGGCGTTTATTAAAGAGGAGAGT
GAAGACATCAAGATTGAAGAAACATTCACAGTCAAACATG
AAGAGACTGAAGAAGCTTTCAGAGTCAAACATGAAGATCC
TGAGGAACAAACAGATCTGATGCCACTGAAGGAAGAGAGT
GAAGTGATTAATGAAGTGGAAGAGAAACCTCACAATGATC
ATGATTACATTGCTGAAGACGGTTCAAACACTGAAAAGGC
TTTCTCAGAACTAAATCCTGGAAGCACATGTTATCTCATT
TATCAACGACACGGAAGCACTTACAGTCAAAAAGTAAACC
TACCAGGACACATTCAGATTCACCAAGGACAAAAAACATA
CACATGCCAAGAGTGTGGAAAGAGCTTTAATAAAAGAAGA
TATCTTCGAGATCACATGAGAGTTCACACTGGAGAGAAAC
CCTACAAGTGCCCTGAGTGTGGAAAGAGCTTTGGACAAGT
GGGACACTGTAATGTCCACATGAGAATCCACACGGGAGAG
AAACCCTACACCTGCCAAGAGTGTGGAAAGAGTTTTAAAG
AAGCAGGAGACCTCAAGGTTCACACGAGAATCCACACCGG
AGAAAAACCCTACTCTTGTCTTCAGTGTGGGAAGGGTTTT
AATCATACGGGACACCTTAAAGATCATGTGAGAATTCACA
CTGGAGAGAAACCCTACACCTGCCCTCAGTGTGGAAAGAG
TTTTGTTCATGTAGGACAATACAAAGTCCACATGAGAATC
CACTCTGGAGAGAAACCCTACACATGCCCGCTGTGCAAAA
AGAGTTTCATCTATAAACTAAGCCTTTCCAGACATGTTAA
AATCCACAAACAACAGAAACCGTACTCCTGCGAGCAGTGC
GGAGATAGCTTCAGTCAGCACGAACACCTGGAGTTCCACA
TGAAGGTTCACTCTGGAGAGAAAGCCTTCACATGCCCTGA
GTGTGGAGAGGGTTATGATCAAATGCCACACTTTGGAGCC
CATGTGAGAACTCACAGTGGAAAGAAACCCTACAAGTGCC
TTCTGTGTGGAAAGAAGTTCAGTCATGGTGCACACCTTGA
AGTTCACATCACAGTTCACACTGGAGAAAAGCCCTACTCT
TGCTCTAAGTGCGGGAAGAGTTTCACACAGAAAGTAAGCC
TCACCAGACACAATAAATCCCACAAGGAAGAAACGCCTTA
AAGCTGCCATCGTATTGGGGTTTCTAACAAAAGGAGACCT
CGAATTCACTTTAAATGAAAATTTTAAAAATTACAATCAA
AATTAAATAAAAAAATTAAATTATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-144d13.4-201 Contained in:
[BAC] CH73-144D13 (1)

Genome Resources: Vega_Trans:OTTDART00000056887 (1),  Ensembl_Trans:ENSDART00000155799 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154476 (1) 1983 nt
GenBank:BC171385 (1) 1374 nt
GenBank:CN322444 (1) 880 nt
CITATIONS (2)