Transcript

osbpl5-201

ID
ZDB-TSCRIPT-131113-2594
Name
osbpl5-201
Previous Names
  • osbpl5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056606 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056606|OTTDARG00000039430|ZDB-GENE-030131-5872 osbpl5|OTTDARP00000044398 osbpl5-001 LG_none CR381672.10,CU570971.4 Danio rerio protein_coding KNOWN, 5493 bp
GCTGAATGACGTCAGGCTTTATGAGGGTTAAATCCAGCAC
CGCGTCTCCACTCTGGCTGGTTAAGCGCCTCCTTTCTTCC
AAAGGCATTTCCTGCCGTCCGCGCTCCCAGAATACACAGC
TGTACGCCAGCGGTTATGGAATGCTATGGACCGCTATTTT
ATCTCTCCATCATCTTCCACCTCTTAAGGATGCAGGTGTG
CAAGGTTAACTTCCAACTTCCAAGCGTTTCGCGTCTGGAA
AACAGCGTTTCGATCGGCCTTTGCACATTTTAAGACGGCA
TTACTTTTGTTTTGGGACAAACGCGAGCTTCGTTTACAGT
TCAATTACATTGAATACATGAGGGACGGTTACTAAGGCGG
TCGGAATAGAACAAGACAACCAGACCTTTTCCAGTGATCT
GAGATGAATTCGTTTGGATACGTCTAGATCTCCTGCCACG
TTTCTGTCTTCGGGGGCTGAAGTTGCGACTGCAACAGAGG
TGGACAGACTGGCTGGTACAATGAAGGAGGAGAACTTGTT
CCGCAGGCGGTTCTCTCTCTGTCCCACAGCCACGTCACCT
CCTAAGATCGACCCCCGTGTGCTGACCCGCAACTTGTCCT
ATGGAGGAGACAATGAACTGTACCCGCTCAGCCCAGGTAA
TGAAACGGAGCGGAACGGTTTGCCCTTACTGAGGGACGAG
GTCAGCCCGGCCCGTTCGCCCAGCAGTGTGTCAGAATCCA
GGATGTTTATTGGTTTGGAGAAGGAGTCTTCTTCGCCCAC
GGAGAAGCTGGCAAGGAAAGAATCGCTTAAGGTTCAGAAA
AAGAACTATCGGCAGGAGAAGAAGAGGGTTGCCAAAGAAC
TCTTTAGTGCACTTAAGGATCCAAGTGTGGTTATTATGTC
CAACTGGCTAAAGATTCGGGGAACATTGAAGAGTTGGACA
AAGTTATGGTGCGTCCTGAGGCCTGGCATCCTCATTATTT
ACAAAACACCTGGTTCAGATCACTGGGTCGGGACGATTCT
TCTCAATGCCTGCAAACTTATTGAAAGACCATCAAAGAAG
GACGGGTTCTGCTTCAAACTCTACCATCCAATGGACAAGT
CAATTTGGGCCATGAAGGGACCTGAAGGAGAAACGGTTGG
CTCCATCACACAGCCCTTGCCTAGTAATTATTTGATCTTC
AGGGCGGCATCTGAATCTGATGGACGCTGTTGGATGGATG
CTCTTGAACTGGCTCTCAGCTGCTCCAGTCTGTCCAAGAT
GACGGCAAAGAGCTGCAGGGATGGAGATCTGAGCAGCTCC
TCAGAGTCCTCACACATACTTCAGCTGCTGCAGTCCTCCG
CTCTCACCGACCAGGAGCTGTTACAGTTGAATGACTCCAT
GTTGGAAAATAATATGGAGAACGATGCCAACTCAGACAAG
TCAGAGAGGGAGGCGCATGAAGACTCGGATAACGCGGCCA
ATGAAAACGGAGGCCGACTGACCGAGGAGAGTGACATGGA
CCAATCGGATGACGTCTGCCTCCAGGCAACGGGATTTGTT
GAAGAAGCCCATGAAGAGATGGGAGAGGCTGGCGAGGCAT
CCCAGGTCGAGACGGTCTCAGATGAAAATAAGGGTTTGAT
ATGGACTCTCCTAAAGCAGTTGAGGCCGGGGATGGACCTT
TCGAAAGTGGTTTTGCCAACATTTATCCTGGAGCCACGTT
CATTTCTTGACAAGCTGTCAGATTACTACTATCATGCCGA
CCTGCTGTCCAAGGCTGTGACGGAGGAAAGTCCATACGGC
AGGATGAAGCAGGTGCTGCGTTGGTATTTGTCAGGTTTCT
ACAAAAAACCAAAGGGGCTGAAAAAACCCTACAACCCTAT
TCTAGGAGAGATGTTTCGATGCTGCTGGCTGCATCCACAA
ACAGACAGCTGCACATTTTACATAGCCGAGCAGGTTTCTC
ATCACCCTCCAGTTTCAGCCTTCTACATCAGCAATAAGAA
GGATGGATTCTGCATTAGTGGAAGCATTCTTGCCAAATCC
AAATTTTATGGGAACTCATTGTCTGCTATATTAGATGGAA
AGGCCAGACTCTTGTTTCTGACCCGAGACGAAGAGTATGT
CATCACAATGCCGTACGCTCACTGTAAAGGTATTCTTTAT
GGCACAATGACATTGGAGCTTGGTGGGAAAATCACCATTG
AGTGTGAAAAAACTCAATGTTATACAGAACTTGAATTCAA
ATTGAAGCCTTTTCTTGGCAGCTCTTGTAATGTTAACCAG
ATTTCTGGAAAGATCCGGATTGGGGAGGATATTCTGGCTA
CAGTAGAAGGACACTGGGACAGCAAAGTGCACCTGATAGA
GAAGAAGACGGGCCACCAGGAGGTGCTGTGGAACCCTGGT
CCAGACATACGCAGACAGAGGCTGAAGAAACGAGTGGTGC
CGATTGACCAGCAGGAGGCGTTCGAGTCCGAGAGGCTGTG
GCAGCATGTGACCCAGGCGATTAATGATAAAGACCAGAAC
AGAGCCACCCAGGAGAAGTTTGTGCTGGAAGAGGCTCAGC
GGCAGGAAGCCAGAGAAAGAGCCGAGCGAGCCTGGAACCC
ACGACTATTCACTCTTGATGCTGACACCAATGAGTGGCAC
TACAAGCATGCAGACACTAAGCCATGGGATCCGGAGCGCT
GTCTGGTGCAGTTTGAGAAAGACGGCATCATCCAAACTAA
AGAGAAGTCGCAGCGCCGACGCAACCGTTACTCCTACAGC
CAGGACTGGGCTGGACAGCAGAAGGTGCGGGTGAATGGCA
AACACAGGAAGTCCAGCAGTCAGCCGTCCAGCTGCAGTCA
GAACACAGAGAGCAGCAGCACCACACCAGAACCCAACCAT
GAGTCATCCGATAATGAAGGCTTTATGAACCAGTGTGCCA
GATGCAGTAAAGAAGTGAAGGACATCGCTCTCATAGAGGC
CTCGGTAGCAGCTATACAGAAAACACAGCAAGACATACAA
AGAAACCTGAGTGCACTGGGTCGTCAGATAGCAAGGCACA
AGACAGCAGAGGAGAGCAAGTCCTTGAGCGGACGCCACTT
TCTTATCCTCTGCATGCTGTTGCTCTTCCAGCTACTCATC
AACCACGTCTTCACTTGAGATGCTGTCACCTAGCAACCAT
CGCCTAGCAATCGTTGCCTAGCAATAAACACAGCCAAACG
ATCACCGTCACACAGCCCCTCGAATGCCCCACCCGTGATG
TTGCTACCAGCTGTAGCAACCGCACCATCAAGCACTAAGC
ACTTCAACTAGGGAGAAAGAGACTCTTGTTTTAATTAATA
TGACAGATAATCATTTCAGAGTGGATGTAGACCGATGTAC
TGCCACTCTCAATAATTGACGCGTTCACACTTTCCTACGT
ACTTCCCTTTCTTTGCAATAGGGGTCATCTTTTTTTTTCT
TTTTGAATGCATTGGAATGGGTTTGTGTGTCTGTCTGTGT
GTGTGCTTTACTCACAAACTCCTCTTCCATTTATACACCG
GGCCTTAATACTGATGCCAAAAAGGGGAAAAATGAACTGA
GAGATCAGTTAAGTCCGCCAGTGCAATTTGCTTTCTGTTT
TTATTTTTTGGCTCACACAAATTTGCTCATCTTATGATTT
TTTTTTTTTTACCAAAATAGTGTTTCTGTACAGAACAATA
ACAAAGAAGAGTAAATGTTTACAAACTTGATTGTACACCA
CACAAAGGAGAACGATGCTCTGACACCAAAAGCGTATAGT
GTAGATGTAGAATAGATTCGGCGGTGGCACTACAGTAAAA
GAATGAACAATCAGCCATAAGACTGAGATATTCATATTCG
TGACTGTTTGTTGGGCATTGGGGAAGAAATTCACAATAGG
GACACGTGAGGCCTTCTGGGAAGTTCCAGGTCATTTGTGT
TGCTCGGGTGAAGCGAGATGTGTTTGCTAACGAAGGCATG
ACTGGCTAGTGGAAAGTGTATATATTTGTTCGAGAACATT
TGAAATTAAGAATGTATTTATTTGATCATTTCACTTGATT
TGTTTTATATATAAACATACTGTTTTTAAGAACACGTTCA
TTCAGGTTTTCCGGGAGCAAGAGTAGTTGAGCACCAATTT
ACAGCGGGGAAAATAAGTGTTAAACATGTCACCATTTTCC
ACTGAAAATCCACAGAAAATCTCTAAAGGTGCTGTTGACT
TGAAATTTTCTACAGATGTCAGTAACATCCAAATAATTTA
AGTAAAATAAAGTAATTAGTTTACAAATTAAGTACTAAGA
TGCCTAATAAAATAAAATGACGCTGGGAAAAATATGACGG
CAATTCTATGGCAAAAATAATCAAGCACACTTGTGATATT
TACGCGCGAGGAGAAGTTAAGGCCAACTCACACTGAGATT
TTTTTAAAATCCTAAATGATCGTAGCATGTTAGGCTTAAC
AAACATGGCTCCCATGTCACACTGTAAGATCTCAGCTTTC
ATAAAGTCAGAGTGAATGACAGTGAACCGGTGCCAAACAC
GCAAGAAGTGCTCCCGGAGTTTGAAGTCATCCACCTGTGA
CACTTTCACTATTCTGCATTCTAAAATGATTCCTCACAGA
AAACGTAAAGAATCTGTAGCGCCAATTTTGCATGTGGCGT
GTCTCAATAATAAAACTAGGAATTGCTGCATGGATTGCAT
CATCATATCTAGAGCTCCTATTGGTTCTTGGGTTGATGCT
CATCGCAGCTGTTGTCACACTGCAGGAAAGTGTCTGAAAT
CTTCTGACACTGCCAGAACTTCATCGGAAGAAAAATCTGA
TTGCAACGAGCATCAAGCAGCTATCTGTGAACATGTCAAA
CCCATAATCAAAGGTCACAGATTTTAGCCCAGGATTTTAG
GAATCTTTTTGGATTTTCCAAATTTGTCTCGGATGTGAGC
AGGGCTTAAACCGCCAGATCACAGACCTACACGCGAGGAA
CCTATTCATCAAATCCTAGCTAACGTCTGGAAAGAGAGGG
TAACCAATAAAAGTTAGAGATAACAATTAAACCAAGTCCC
GCCCCAAGGCTGACAAAAATCCAAAAAGATTTGCGCGATC
AAAGAGAAGAGCCAGCAAGCAAGTAAAAGAACTGCTGTGA
GGCATAACCTCGCTCACGAGAGCATCCATTGTGCACACAG
ATGATAATTTGCGCGCACAAGGGTTTACAGCGAGCTTACG
AGGACCTGTTTTCTTACGCTAGATCACTTCAGCATGCGCG
TGAACATCCCCTGTCCACGTGCGAGCAGTGGCGGATTTAC
CCTATAAGCAAAGTAAGCAGCTGCGTATAGCCTCAATACA
TTGAAGTAAAAACTATACACATAACATTGTTTTCTATCAT
ATTTTGTATGGTGAGGGTCTAACAAATAAAATTTTAACAT
AATTATAACATCTACACAAATTTGTCTAACAACCCCAACC
ATGGAGCAGTCAAGTCAGGTAAAGATTTTTATTATTTTTG
GTTTATATTATTATTATTATTTTTGTGTGTGTGTGAATTC
ATAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations