ZFIN ID: ZDB-TSCRIPT-131113-2576
Transcript Name: si:dkeyp-93a5.3-201
Previous Names: dkeyp-93a5.3-001, si:dkeyp-93a5.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056542 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056542|OTTDARG00000039378|ZDB-GENE-131127-100 si:dkeyp-93a5.3|OTTDARP00000044347 DKEYP-93A5.3-001 LG_ CR792430.33 Danio rerio protein_coding PUTATIVE, 1347 bp
GGAGACTGCAAGACGCACAGAAGACTAAACTATCACAGAC
ATCCAGAAACCCAGCCAGTGAAGAGTCCGAGTAAAGATGT
GGTGGAAAACCTGTGTGACTTTACTCCTGCTGATGTATGT
CAGAGATTCACTTTCTAATTTGCAAGTATGTGGACGTCCA
AACCCCACATTAAATCCTCGCATTGTGGGTGGTGTGAATG
CAACTCATGGCGCGTGGCCGTGGATGGTCAGTCTGCAGGG
CAGATATGGCCATTTTTGTGGCGGCTCCCTCATCAACAAT
CAATGGGTGCTGACAGCAGCTCACTGCATTGTTGATCAAA
CCCCATCCAGCATAATTGTGTACTTAGGAAAGTGGAGAAG
TTATGTAGCTGATGTCAATTCAATCTCCAGAACTATCAGA
CACATCATTCCCCATCCCTCCTACAGTAACATAACTAAAG
ATAATGACATCGCTCTGCTGCAGCTGACATCTACAGTCCA
ATATACTGACTACATTAAACCCATATGTCTAGCAGATGAA
AACAGCAACTTCCCTCGTGGCACCAACAGCTGGGTCGCAG
GCTGGGGGGATATTGGAGTTTTGGGCACAGGTGGTATAAG
AGGCAGAACCACAGTGTCTGTGCCTTTACCTCATCCTGGC
ATTCTGCAAGAGGCTGAGCTTAAAGTGTACAGTAATGCAG
ACTGCAATAATATTTGTCATGGACGGATCACCCCCAACAT
GATTTGTGCTGGTACACGTCCTGGAGGCAAAGCAACCTTT
TCTGGGGACTCTGGTGGTCCACTGATGACTAAGTGTTCAG
TGTGGGTTCAGGCTGGTGTTCTCAGTCATGGTTATGGATG
CGCACAGCCCAATCTTCCTGAGGTGTTCATTCGTGTCTCA
GAGTATAAGCAATGGATTACAGGCAATGTCGGTGGAAACC
TGCCTGGATTTGTCCTCTTTGACCCAAGATGTTCTCTTCG
CAAAGTTCTTAATAGAGTCTTCTGCTGCTTTGGATAAAAA
AAACTGCTGCAGTGAATATGTATATGATGCTCTGATTATA
CCTTCACACCTGCCTATCACATGATGAAGTCTCTTCTTGA
CTGCTGTCTTTGAGGCTCTACTTCTGGCCAATGTTGATCT
GGAAACTCCTCAGTGTTAGTACTGCAAGACTCTTTCTTAC
ATTTCTTCACAAGTGCTAATATTGAACCTGATGTGACAAG
TCTTCTGGCATTCCACCACCACTGCAGATATTTAAAATGC
ATTGCTTCCAATATGTATAATAGTTTCTCATATTGTAAAT
GACATAATACCATGGTGATTGAATCATGATAGAAAGAGCA
CTTCATTGTGTGCACAGCATGTGCAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-93a5.3-201 Contained in:
[BAC] DKEYP-93A5 (1)

Genome Resources: Vega_Trans:OTTDART00000056542 (1),  Ensembl_Trans:ENSDART00000155354 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133900 (1) 1602 nt
GenBank:CK873046 (1) 949 nt
GenBank:DT065636 (1) 740 nt
GenBank:EV556111 (1) 713 nt
GenBank:EX159086 (1) 384 nt
CITATIONS (2)