Transcript

si:dkeyp-93a5.3-201

ID
ZDB-TSCRIPT-131113-2576
Name
si:dkeyp-93a5.3-201
Previous Names
  • dkeyp-93a5.3-001
  • si:dkeyp-93a5.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056542 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056542|OTTDARG00000039378|ZDB-GENE-131127-100 si:dkeyp-93a5.3|OTTDARP00000044347 DKEYP-93A5.3-001 LG_ CR792430.33 Danio rerio protein_coding PUTATIVE, 1347 bp
GGAGACTGCAAGACGCACAGAAGACTAAACTATCACAGAC
ATCCAGAAACCCAGCCAGTGAAGAGTCCGAGTAAAGATGT
GGTGGAAAACCTGTGTGACTTTACTCCTGCTGATGTATGT
CAGAGATTCACTTTCTAATTTGCAAGTATGTGGACGTCCA
AACCCCACATTAAATCCTCGCATTGTGGGTGGTGTGAATG
CAACTCATGGCGCGTGGCCGTGGATGGTCAGTCTGCAGGG
CAGATATGGCCATTTTTGTGGCGGCTCCCTCATCAACAAT
CAATGGGTGCTGACAGCAGCTCACTGCATTGTTGATCAAA
CCCCATCCAGCATAATTGTGTACTTAGGAAAGTGGAGAAG
TTATGTAGCTGATGTCAATTCAATCTCCAGAACTATCAGA
CACATCATTCCCCATCCCTCCTACAGTAACATAACTAAAG
ATAATGACATCGCTCTGCTGCAGCTGACATCTACAGTCCA
ATATACTGACTACATTAAACCCATATGTCTAGCAGATGAA
AACAGCAACTTCCCTCGTGGCACCAACAGCTGGGTCGCAG
GCTGGGGGGATATTGGAGTTTTGGGCACAGGTGGTATAAG
AGGCAGAACCACAGTGTCTGTGCCTTTACCTCATCCTGGC
ATTCTGCAAGAGGCTGAGCTTAAAGTGTACAGTAATGCAG
ACTGCAATAATATTTGTCATGGACGGATCACCCCCAACAT
GATTTGTGCTGGTACACGTCCTGGAGGCAAAGCAACCTTT
TCTGGGGACTCTGGTGGTCCACTGATGACTAAGTGTTCAG
TGTGGGTTCAGGCTGGTGTTCTCAGTCATGGTTATGGATG
CGCACAGCCCAATCTTCCTGAGGTGTTCATTCGTGTCTCA
GAGTATAAGCAATGGATTACAGGCAATGTCGGTGGAAACC
TGCCTGGATTTGTCCTCTTTGACCCAAGATGTTCTCTTCG
CAAAGTTCTTAATAGAGTCTTCTGCTGCTTTGGATAAAAA
AAACTGCTGCAGTGAATATGTATATGATGCTCTGATTATA
CCTTCACACCTGCCTATCACATGATGAAGTCTCTTCTTGA
CTGCTGTCTTTGAGGCTCTACTTCTGGCCAATGTTGATCT
GGAAACTCCTCAGTGTTAGTACTGCAAGACTCTTTCTTAC
ATTTCTTCACAAGTGCTAATATTGAACCTGATGTGACAAG
TCTTCTGGCATTCCACCACCACTGCAGATATTTAAAATGC
ATTGCTTCCAATATGTATAATAGTTTCTCATATTGTAAAT
GACATAATACCATGGTGATTGAATCATGATAGAAAGAGCA
CTTCATTGTGTGCACAGCATGTGCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations