Transcript

lrrc29-201

ID
ZDB-TSCRIPT-131113-2572
Name
lrrc29-201
Previous Names
  • lrrc29-001
  • ch73-336h18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056506 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056506|OTTDARG00000039351|ZDB-GENE-030131-7165 lrrc29|OTTDARP00000044310 CH73-336H18.1-001 LG_ CU855816.4 Danio rerio protein_coding NOVEL, 2601 bp
GGTTCCTGTGTCCGTTCCTGGTCCGTTCATTCTTATTTTC
TTCTTAAAACATGTTTTTTCAGTTCGCTTGGCGAGGAGTT
TACCTTTCTGAGGGCTTTTAGGATGTATTGTCGATAATTT
TACATTTGAGGGAACGTTTTGTAACTGTCAGGAACAACAA
GATGGTCTCATGTTTATAAAATATTAAGCAAGTTGACAGT
CAACATCGTGACGCGACTTCTAGACAAATCTTTGTCAGCG
ATTTAATATCGACACTAAATAGGTATAAATAATAATCAAT
GAGGCCAGATGACTGAGGTCAGTTCACAGTCATGGAGAGT
CTACATTTGCCTTCTGAGATCATTACCTACATATTTAGTT
TTCTGCATGTAATGGATCGAAAGGAAGCGTCACTGGTCTG
CAAGAGCTGGTACAATGCAAGCCAAGACTATCCGTTTAAG
AGAAACCTTACCTTCAAGTTTCCAGCATCCTCCTCTTCTC
TGGGCTTCATCCGAGGTCTTGCGAGACATCCTCGCTGTGG
CCTGGTCATCAGCCATCTGGATGGGTCCAGTGTGTCCAGG
CAGGTGCTGCTTGAGGTCGGGCTTCACCTCGGGCCTCGGC
TTGACAGTCTGGCCCTGCCTGGCAGCAGTATCACCGAGTC
CTGCCTGCTGGAGCTCCTGCCCCGACTGACCAGCCTCCGC
AAGCTGGACCTGCAGGGTCTCGACAGCCTCTTCATGTCTG
GAGCTTTTCTGTCCAGAGAGGAGCACCGGCGGAAGGTCTA
TCGTGCTCTGCTGAACCTGGAAGAACTGAACCTGTCTAAT
CTGCGCTACCTCTCTGACCTCTCCTTCAACCGGCTGACCA
TTTGCACTCCTGGACTGCGGCGTCTCTCTCTTTCTGGGTG
CCACATCTCCTTCGAGTTTGACCCGTACCGAGGCTGTCCT
GTAGGCTCCGGCTCCTCCGCTCTGGTTTCCCTCCGAAACC
TTCTGAATCTCCTCCAGAAGCAAACCTCCACCCTCCGCAG
CCTGGACCTGAGCCGCACCGGCATCACACCGAAGTCCCTC
CGCTCCATTTCCAAGCTCCGCGGCCTCCGTCTGGAGGAGC
TGAATCTGCACGGCTGTAAAGAACTGACCGATTACTCCAT
CGAGATCCTCTGTAAGTATCAGAGCGGCCTGCGGATGCTG
GATTTGAGCGGCTGTATGGAGCTGAGCTGCAGGGCGGTGC
TGGCGGTGGGTGCGGAGCTGAAGGAGCTGAGGGTCCTTTC
GTTCTCGCAGGACTGGAAGATCACAGATAAAGGTCTGGCC
GAGCTGATGATGCTGCCGCATTTGAGGAGCCTGGATCTGT
CAGAGTGTCTGCATGTGAGCGGGACAGAGCTGGTCAAAGG
CTTGTCTGGTCCAGAACCCAGAGCGCAGGTGGAGACCCTG
AGCCTGAGGAACTGCACATATATTAGGGATTCAGTGGTGT
TTTCGCTGGCGCAGCTGCTGGGTGTTCATCTGCGAGAGCT
GGATCTGTCCTCATGTGTTTATCTCACTGATCTGAGTGTC
CGAGCCATCGCCACCTTCCTGCCCGCTCTGCTGGTGCTGC
GGCTCGGCTGGTGCAAGGAGATCTCAGACTGGGGGCTGCT
GGGCATGACAGAGCCCACCAAACACTGCCAGCCCTCTGAC
AGAGAGGAGGATAAAGGGCCGAGCTTTACTAGGACGTTTG
GAAACATGGGCTTTTTCCAGCCTCCGAGCCTGCCTTTCCA
GGACAAGCCCCGTCTGGTGACGGATGAGGATCTAGAGGAG
TTCAGGGATCAGCAAGGTGCATCACTGCTGGCCCTCAGAG
AACTTCAGGTGCTGGAGCTTACAGCCTGCTCAAAGCTCAC
CGACACCAGCATCACACAGGTCCTCCGTTTTCCCGAGCTG
CAGCGTCTCTCGCTCTCCATGCTGCCTGAGATCACTGACG
ACAGCCTGGTGTCTGTAGCTCTTCACTGCTGCAGCCTCAC
CAGCCTTTCGCTCAGCCACTGTCCTCAGATCAGTGATAAG
GGCATGGCTCGAGCTCTTCCGCTTCTCCACAGACTCCAGC
ACCTCTATCTGGCCTGCTGTAACGCCATCACCAATGAAAC
TCTGTCCATCATTGCTCTGCATTGCGATAGACTGCGAACC
CTCGACGTGTCCATGTGTAAAGACATAACAGTGCACCAAG
TGGACCTCCTTCAGTCCCGACTACCCTTCCTGGAGAAAGT
CCAGTGCCGCTTCGCCAACGGGGCAGATTTCACTATGGTA
TTATGAAGCTATAGCATCCTGCTAAAGGTGTGTGGTATTT
ATGATCTAATGTCCTTTTTTCTTTGCAAGCTGATATTAGA
TTGTTTTGGGACAAAAAAAAAACCCTGAAAATGATTCACT
TTCACCAAAGAAAATTGTTCAAAACAAACCTGGAACTGAG
CTAAAGCCACTTTAAAAAGTGACCAGTGTAAACATTCATA
TCAAGTTAGAGAGAGCTCAACCAAAATCTAAAAGGTGATC
TTTTTTTCATTGATAAGTCAAAAAAAACATCCACTTCTGA
AATGTAAATGTTGGCCGTTTTTATAGCCAGAAGCTGTGGA
TCTTTGTTGTAAAACAGGGGTATCCAAACTCAGTCCTGTA
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations