header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2566
Transcript Name: galnt8a.1-201
Previous Names: galnt8a-001, galnt8a.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056485 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056485|OTTDARG00000039339|ZDB-GENE-091015-4 galnt8a.1|OTTDARP00000044293 galnt8a-001 LG_ BX004976.7 Danio rerio protein_coding KNOWN, 2398 bp
GAACAGAGTAAAGGCAACAGGTTACAAAGGGCAGAAGATC
TGGATGTTCTTCAAAGACTGAAGAGAATAGAAGATCAAGT
TCATCATTTAGAAGTCAAAAAGTCAAAGAGGCTCCTGTGG
GACAGAAAATTACAAAGAAAACTGAGGTGAAGAAGTTGTA
TCCGAATTCACCGCTCTTCAGTTCATGGGGAGCTGAACTG
ACAGAGGAGGAACAGATGGAAGCAGAGAAACTGTTTCAGG
AGTTTGGATACAATGTTTTCCTCAGTAACAGATTACCCTT
GAACAGAACAATCCCTGATACTCGAGACCCCAGATGTGCT
CTGAAGATCTATCCTAAGGACTTGCCAACCATTAGTGTGA
TTCTGATTTATCTGAATGAGGCTCTGTCAGTCATTAAAAG
AGCCGTTCACAGCATCATTGACAAAACTCCTGCTCATCTG
CTAAAGGAGATCGTCCTGGTAGACGACAACAGCTCTAATG
AGGACCTGCAATTGCCTTTAAACAAATATATTGATCTAAT
TAACAAAGCTAAACCTGGATTAATCAAGAAAGTGCGACAC
AAAAGGCAGATGGGTCTGGCCAAGGCAAGAATGTCAGGTT
GGGAAGCTGCCACAGGTCAAGTGGTCGCCATTCTGGATGC
CCACATTGAAGTTCATAAGGAATGGGCAGAGCCACTACTT
GCACGAATTAAAGCAAACAGAACAACTGTATTGTCACCAG
TGTTCGACAAAGTGCTCTTTGACACACTGGAGGTTATTAA
CTATAATCCTGCTGCTCATGCTTTTGACTGGAGCCTTTGG
TGCATGTACGAGTCCTTTCGGCCAGAATGGTACAAACTGA
ATGACCCATCAGAACCAGGGAAGAGTCCCTCAGTCATGGG
TATCCTTGTCGCTGATCGTCAGTTCCTGGGAGAAATTGGA
GCACTGGATGATGGAATGACAATTTATGGTGGTGAAAATG
TAGAACTGGGAATACGTGTCTGGCTCTGTGGTGGGAGTGT
TGAAGTGGTGCCGTGTTCAAAGATTGCGCACATTGAAAGA
GCACATAAGCCTTATTCACCAGATCTCAGCAAACCCATGA
TCCGAAACGCATTGAGAGTGGCTGAAATCTGGATGGATGA
ATATAAATCCAATGTGAATATTGCCTGGAATCTGCCTCTG
AAGGATCATGGGATTGATATTGGTAATGTGACTGAAAGAA
AACAGTTACGTGAGAAACTCAAATGTAAGCCCTTCAAATG
GTATCTGGAAAATGTCTATCCTCAGCTTGACAGATGGGAT
GGCATAATGGCTTATGGCACGTTGAAGAATGACATTCTTG
AAAACTTTTGCATTGATCAAGGACCTGTTCCTGGAAGTGT
GCCTATTCTCTACGGATGTCATTACTATGAGCCTCAGTAT
TGTTTTTACAACCAAAATGGAGAAATCTACATTGGTGGCA
TTAAATCCCACACTTATAATTCTAACCGTTGTCTAACGGA
TCCTGGCAGTGGAAGCACACCGGCTTTACATAACTGTAAA
AATGCACAGGAGAAAGGAATGAACATTTACTGGGACTTCA
CTCAGGGAAATGCAATAAGAAATAGAAAAACAAACCGATG
TCTTGAGATCGGCCAAGGAGTGGATTCATACTATACCCTC
ATTCTGCAAACATGCACAGGACAAAAATGGACAATTCAGC
ATGTCATCAAAAACCTTTAAAGGGAATTATCACACAAGTA
AAAACATTGTCAGGGGAATCAATGTAAAATAATCCTCAAA
ACAAAACATAAAAGAGATCATTGCAGATATTAATTGCGAT
TGGTTGAAATGTACTTGATTTGATGTTTTGGTATTTTATA
AAAGCAATAGGTGAATTTAAAGGAGTTAGCATGTGGCAAA
AAAACTTACCTGTTGAGAAGAAACTCCTACTTTCTGGAAG
TAAATCAACAGCCATATTTTGTCAGCTCTGTAAAAGGATA
GCATCCATCCTACTGTTATCGAAGAAAAAAACTGGCCAGG
AATATCAGCATGTTGCATAAACCTGAAGGGTTTTACGCTG
TATCCTAACTACATTGGACGCAACACGATGAAAGGTATCT
GTTCCATGTTAAAATAAGTTTTGTCTTAACCATCAGTGAC
ACGCAAAATTTCTATTTTGAAGCAGGTTCTATTTTCTGCC
TCTTCGCAGCAAAACAACAGCATATTTTACTATGGCAATT
TTTACTTCTGGTACCAATTATGTGTTTTATTCATGTGTTT
AAAATGCTATCAATGTGAGTTTGAATATCATTATATGTTA
CATTTATTGCCATACTACTGAAAGCAGCAGTAGATACTGT
AGTTCACCTCAGAGCTTGAAAATAAAATAACTAGCAGACA
GTTTGAAAATGAAAGTCAGAACTGTCTGTCACTGAAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
galnt8a.1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056485 (1),  Ensembl_Trans:ENSDART00000156091 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)