ZFIN ID: ZDB-TSCRIPT-131113-2551
Transcript Name: mhc1lga-202
Previous Names: dkey-52p2.6-001, mhc1lga-001, si:dkey-52p2.6-001 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056418 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056418|OTTDARG00000039299|ZDB-GENE-140820-8 mhc1lga|OTTDARP00000044236 DKEY-52P2.6-001 LG_ CR854891.10 Danio rerio protein_coding PUTATIVE, 936 bp
AAAGAAGTGTGGTTTTGTAGTGAGCAGAAGTGAGTGCTGA
TACAATCTGCTAGAAATATGTGCAAAATTATTTTTCTCCT
TTTGTTTTTACTTCCAGCTGCAGCTCCTAAAGGCTCTCAT
TCTTTATGGGTTGTTGCAACGTACATTAAAGGACAAACAC
CATTTCCTGAATTTAGTTATGTATTGATGTTGGATGATAT
CACAGTTATGTACTATAACAGTGATACAAAGACTTTTTTT
CCGAGAGGAAACACAACAGCTGAAGATGATTTGTATGGTT
CAAAAGATCACCTCATCATACATGATTTTATGCGTTCAAC
TTTTAAGGACAAATGGGGATTAGCAACAAAAAAATTGAAT
AAAACTGATGGTGTCTTTGCCCTACAGCAGCTGGTTGTGC
TTGACCTAAGGGCCGATAGTGAACCAGGACAAATTATTTC
ACAAAATACTTTTGAAGGATGTATCACAGATGAGGTGCGA
TATGTTGACAAGAAGCTTACATACCAGGGTACTTTAAATG
TCTCGGCTCCTGTGCATCATATTCATCATGAATACGTCAA
GTACCTCTGTGAAACATTAATACATCCATTTTACTTCAAA
ACACTCAAAGGTTACCTTATAAAAAGGAGAAATCAAATCA
ATAGAAAAGGTAAAATGACAGACTCCAGCATAGAAAGTTG
ACAAATAATTTACTTTTAGCATTTTTCAGGCTACAATATA
TCAAAAGATTCTCTTTCTGTTGTCTCTTTTCCAGTCAAAC
CCAAAGTCAGACTCATTCTGAAAGCAAACTCAGATTCTGG
AGGGTTTCGTGTGAGTTGTTTGGCGACAGGGTTTTACCCT
CGTCACATCAACCTGACCCTGTTGAGAGATGGACAGCCTG
TATCTGATCATGGGGTCACTGGAGGAGATCTGCTGCCCAA
TGGAGACGGGACGTAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mhc1lga-202 Contained in:
[BAC] DKEY-52P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000056418 (1),  Ensembl_Trans:ENSDART00000156646 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH434628 (1) 963 nt
GenBank:EH434256 (1) 859 nt
CITATIONS (4)